View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_36 (Length: 284)

Name: NF1429_low_36
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_36
[»] chr1 (7 HSPs)
chr1 (11-267)||(8787820-8788076)
chr1 (133-267)||(8782184-8782318)
chr1 (127-196)||(8782055-8782124)
chr1 (19-95)||(8787660-8787736)
chr1 (105-267)||(8776166-8776328)
chr1 (11-75)||(8781981-8782045)
chr1 (31-79)||(8782124-8782172)

Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 7)
Name: chr1

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 11 - 267
Target Start/End: Original strand, 8787820 - 8788076
11 cacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttgnnnnnnntaatgaac 110  Q
    ||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||       ||||||||    
8787820 cacagattggtcaatctgggtagtgagtcgctaggacaaatttcatgttttaagcaaaattcactagtttctgatccggcatttgaaaaaaataatgaac 8787919  T
111 taatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctc 210  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8787920 taatccttaattctgcgacgattgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctc 8788019  T
211 cgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 267  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
8788020 cgatccagatgttactattttggaaccttatcaagtttgtgaagatacccctttcgt 8788076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 133 - 267
Target Start/End: Original strand, 8782184 - 8782318
133 tgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttg 232  Q
    |||||| ||||||||||||||||||  | |||||| ||||||||||||| ||| ||||||||||||||||| |  ||||||||||||||| |||||||||    
8782184 tgttgacggtgataaggagtatatgcatggtaagagtaccacaaacacatccaaggtggaggatgggggtattccctccgatccagatgtaactattttg 8782283  T
233 gaaccttatgaagtttgtgaagatacccctttcgt 267  Q
     || |||||  | ||||||||| || |||||||||    
8782284 aaatcttatccaatttgtgaagctaaccctttcgt 8782318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 196
Target Start/End: Original strand, 8782055 - 8782124
127 gacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggat 196  Q
    ||||| ||||||||||||||||||||||||  || |||||||||||| ||||||| ||| ||||||||||    
8782055 gacgattgttgatggtgataaggagtatatccgtggtaagaataccaaaaacacatccaaggtggaggat 8782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 8787660 - 8787736
19 ggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttg 95  Q
    |||||| ||||| |||||||| |||||||||| |||| ||  |||||||||||||||| |||||||||| |||||||    
8787660 ggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttg 8787736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 267
Target Start/End: Original strand, 8776166 - 8776328
105 atgaactaatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaa 204  Q
    |||||| | |||||||||||| ||||| ||||||||  |||||||||||| |  ||   ||||||||||| |||||| |||  |||||||||| |  |||    
8776166 atgaacaattccttaattctgtgacgattgttgatgacgataaggagtattttcgtgacaagaataccaccaacacatccaatgtggaggatgagaataa 8776265  T
205 ttgctccgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 267  Q
    || ||| ||| ||||| | | |||||||||  |||||  | |||||||| | |||||||||||    
8776266 ttcctctgattcagatctgattattttggattcttatccaatttgtgaaaacacccctttcgt 8776328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 8781981 - 8782045
11 cacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcact 75  Q
    ||||||| ||| ||||| ||||||||||| |||||| |||||||| || |||||| |||||||||    
8781981 cacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcgaaattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 8782124 - 8782172
31 tagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtt 79  Q
    ||||||||| ||||||||||||||| || |||||| |||||||||||||    
8782124 tagtgagtcactaggacaaagttcaagtgttaagcgaaattcactagtt 8782172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295478 times since January 2019
Visitors: 3016