View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_38 (Length: 275)

Name: NF1429_low_38
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_38
NF1429_low_38
[»] chr8 (4 HSPs)
chr8 (1-260)||(6241043-6241305)
chr8 (91-260)||(6249537-6249706)
chr8 (9-73)||(6226701-6226765)
chr8 (82-143)||(6226786-6226847)
[»] chr1 (1 HSPs)
chr1 (80-260)||(17545152-17545332)
[»] chr2 (2 HSPs)
chr2 (91-260)||(42718608-42718777)
chr2 (124-238)||(17533680-17533794)
[»] chr4 (1 HSPs)
chr4 (124-170)||(52329152-52329198)


Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 6241043 - 6241305
Alignment:
1 cgcattttgtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttagtcgtatagatgtcatataatgtctcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6241043 cgcattttgtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttagtcgtatagatgtcatataatgtctcta 6241142  T
101 gcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaag---ggtcagctcatcacgctttgcctcaattgtcacaggctttttcat 197  Q
    | ||||||||||||||||||| ||||||||||||||||||||||||||||||   ||||||||||||||||||||||| |||||||||||||||||||||    
6241143 gtttccacttttcctcgtcaacgttgacataaaactgcttgataccctcaagggtggtcagctcatcacgctttgcctgaattgtcacaggctttttcat 6241242  T
198 gaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
6241243 gaacttcctagtaatctcaagggcttcaggtggcattgtagaagagattactccaacctgaat 6241305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 91 - 260
Target Start/End: Original strand, 6249537 - 6249706
Alignment:
91 aatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggct 190  Q
    |||||||| |||||||| | |||||  || |  ||||||||||||||||||||||| |||||||||||||| ||||||||| |    ||| |||| ||||    
6249537 aatgtctcaagcttccattcttccttatcgacattgacataaaactgcttgataccttcaagggtcagctcgtcacgctttacgaggattctcactggct 6249636  T
191 ttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    | |||||||||||||||||||| ||||||||||||||||||||||||| | | | |||||||||||||||    
6249637 tattcatgaacttcctagtaatctcaagggcttcaggtggcattgtagcagaaaatactccaacctgaat 6249706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 6226701 - 6226765
Alignment:
9 gtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttag 73  Q
    ||||||||||||||||||||||  |  |||||||||||| || || |||||||||||| ||||||    
6226701 gtccatgagccagtccactttgtccatggtattcacaaagacgatacaatgagtgatggatttag 6226765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 82 - 143
Target Start/End: Original strand, 6226786 - 6226847
Alignment:
82 atgtcatataatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgat 143  Q
    |||||| ||| ||||||||||||||||| ||||| |||||  |  |||||||||||||||||    
6226786 atgtcacatagtgtctctagcttccactcttccttgtcaacatccacataaaactgcttgat 6226847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 80 - 260
Target Start/End: Complemental strand, 17545332 - 17545152
Alignment:
80 agatgtcatataatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaat 179  Q
    |||||||  ||| ||||||||||||||||| |||||  ||||  | |||||||||||||||||||||||||||||||||||||||| ||||||||| |||    
17545332 agatgtcgcatagtgtctctagcttccactcttccttctcaacatcgacataaaactgcttgataccctcaagggtcagctcatcaggctttgcctgaat 17545233  T
180 tgtcacaggctttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||    
17545232 tgtcacaggctttttcatgaacttcctagtaatctcaagggcttcaggtggcattgtagcagagattactccaacctgaat 17545152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 91 - 260
Target Start/End: Complemental strand, 42718777 - 42718608
Alignment:
91 aatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggct 190  Q
    ||||||||||| ||||||| ||||| |||||  || || || |||||||||||||||||||||||||  |||||||||||| ||  |||| |||| ||||    
42718777 aatgtctctagtttccactcttccttgtcaacattcacgtagaactgcttgataccctcaagggtcaattcatcacgctttaccagaattctcactggct 42718678  T
191 ttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    | |||||||||||||| || || || || || || || |||||||||| | |||  ||||||||||||||    
42718677 tattcatgaacttccttgtgatctccagagcctctggaggcattgtagcagagaacactccaacctgaat 42718608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 238
Target Start/End: Original strand, 17533680 - 17533794
Alignment:
124 ttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggctttttcatgaacttcctagtaatatcaagggctt 223  Q
    |||||||| ||||||||||||||||| | ||| ||||||||||||||  |   |||  ||||||| || |||||||||||||| || || ||||| || |    
17533680 ttgacatagaactgcttgataccctccaaggtgagctcatcacgcttcacaagaatcctcacaggtttgttcatgaacttccttgtgatctcaagtgcct 17533779  T
224 caggtggcattgtag 238  Q
    |||| ||||||||||    
17533780 caggaggcattgtag 17533794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 52329198 - 52329152
Alignment:
124 ttgacataaaactgcttgataccctcaagggtcagctcatcacgctt 170  Q
    ||||||||||||||||| |||||||| | ||| ||||||||||||||    
52329198 ttgacataaaactgcttaataccctctaaggtgagctcatcacgctt 52329152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216733 times since January 2019
Visitors: 2908