View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_38 (Length: 275)

Name: NF1429_low_38
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_38
[»] chr8 (4 HSPs)
chr8 (1-260)||(6241043-6241305)
chr8 (91-260)||(6249537-6249706)
chr8 (9-73)||(6226701-6226765)
chr8 (82-143)||(6226786-6226847)
[»] chr1 (1 HSPs)
chr1 (80-260)||(17545152-17545332)
[»] chr2 (2 HSPs)
chr2 (91-260)||(42718608-42718777)
chr2 (124-238)||(17533680-17533794)
[»] chr4 (1 HSPs)
chr4 (124-170)||(52329152-52329198)

Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 6241043 - 6241305
1 cgcattttgtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttagtcgtatagatgtcatataatgtctcta 100  Q
6241043 cgcattttgtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttagtcgtatagatgtcatataatgtctcta 6241142  T
101 gcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaag---ggtcagctcatcacgctttgcctcaattgtcacaggctttttcat 197  Q
    | ||||||||||||||||||| ||||||||||||||||||||||||||||||   ||||||||||||||||||||||| |||||||||||||||||||||    
6241143 gtttccacttttcctcgtcaacgttgacataaaactgcttgataccctcaagggtggtcagctcatcacgctttgcctgaattgtcacaggctttttcat 6241242  T
198 gaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
6241243 gaacttcctagtaatctcaagggcttcaggtggcattgtagaagagattactccaacctgaat 6241305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 91 - 260
Target Start/End: Original strand, 6249537 - 6249706
91 aatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggct 190  Q
    |||||||| |||||||| | |||||  || |  ||||||||||||||||||||||| |||||||||||||| ||||||||| |    ||| |||| ||||    
6249537 aatgtctcaagcttccattcttccttatcgacattgacataaaactgcttgataccttcaagggtcagctcgtcacgctttacgaggattctcactggct 6249636  T
191 ttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    | |||||||||||||||||||| ||||||||||||||||||||||||| | | | |||||||||||||||    
6249637 tattcatgaacttcctagtaatctcaagggcttcaggtggcattgtagcagaaaatactccaacctgaat 6249706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 6226701 - 6226765
9 gtccatgagccagtccactttgcgctcggtattcacaaaaacaatgcaatgagtgatgaatttag 73  Q
    ||||||||||||||||||||||  |  |||||||||||| || || |||||||||||| ||||||    
6226701 gtccatgagccagtccactttgtccatggtattcacaaagacgatacaatgagtgatggatttag 6226765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 82 - 143
Target Start/End: Original strand, 6226786 - 6226847
82 atgtcatataatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgat 143  Q
    |||||| ||| ||||||||||||||||| ||||| |||||  |  |||||||||||||||||    
6226786 atgtcacatagtgtctctagcttccactcttccttgtcaacatccacataaaactgcttgat 6226847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 80 - 260
Target Start/End: Complemental strand, 17545332 - 17545152
80 agatgtcatataatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaat 179  Q
    |||||||  ||| ||||||||||||||||| |||||  ||||  | |||||||||||||||||||||||||||||||||||||||| ||||||||| |||    
17545332 agatgtcgcatagtgtctctagcttccactcttccttctcaacatcgacataaaactgcttgataccctcaagggtcagctcatcaggctttgcctgaat 17545233  T
180 tgtcacaggctttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||    
17545232 tgtcacaggctttttcatgaacttcctagtaatctcaagggcttcaggtggcattgtagcagagattactccaacctgaat 17545152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 91 - 260
Target Start/End: Complemental strand, 42718777 - 42718608
91 aatgtctctagcttccacttttcctcgtcaatgttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggct 190  Q
    ||||||||||| ||||||| ||||| |||||  || || || |||||||||||||||||||||||||  |||||||||||| ||  |||| |||| ||||    
42718777 aatgtctctagtttccactcttccttgtcaacattcacgtagaactgcttgataccctcaagggtcaattcatcacgctttaccagaattctcactggct 42718678  T
191 ttttcatgaacttcctagtaatatcaagggcttcaggtggcattgtagaaaagattactccaacctgaat 260  Q
    | |||||||||||||| || || || || || || || |||||||||| | |||  ||||||||||||||    
42718677 tattcatgaacttccttgtgatctccagagcctctggaggcattgtagcagagaacactccaacctgaat 42718608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 238
Target Start/End: Original strand, 17533680 - 17533794
124 ttgacataaaactgcttgataccctcaagggtcagctcatcacgctttgcctcaattgtcacaggctttttcatgaacttcctagtaatatcaagggctt 223  Q
    |||||||| ||||||||||||||||| | ||| ||||||||||||||  |   |||  ||||||| || |||||||||||||| || || ||||| || |    
17533680 ttgacatagaactgcttgataccctccaaggtgagctcatcacgcttcacaagaatcctcacaggtttgttcatgaacttccttgtgatctcaagtgcct 17533779  T
224 caggtggcattgtag 238  Q
    |||| ||||||||||    
17533780 caggaggcattgtag 17533794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 52329198 - 52329152
124 ttgacataaaactgcttgataccctcaagggtcagctcatcacgctt 170  Q
    ||||||||||||||||| |||||||| | ||| ||||||||||||||    
52329198 ttgacataaaactgcttaataccctctaaggtgagctcatcacgctt 52329152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111513 times since January 2019
Visitors: 1375