View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_44 (Length: 256)

Name: NF1429_low_44
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_44
NF1429_low_44
[»] chr7 (2 HSPs)
chr7 (1-256)||(4814721-4814976)
chr7 (1-256)||(4782290-4782545)
[»] chr1 (3 HSPs)
chr1 (57-152)||(36132446-36132544)
chr1 (103-155)||(18786921-18786973)
chr1 (57-158)||(17427621-17427724)
[»] chr5 (1 HSPs)
chr5 (71-158)||(21321923-21322012)
[»] chr2 (2 HSPs)
chr2 (102-158)||(31122676-31122733)
chr2 (101-157)||(15676553-15676609)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 4814976 - 4814721
Alignment:
1 ttgtttttaggggatttgatcccttggatgcttggtgagctgaagtctataggtaattgaatttagtttttgtggtcattcaggaggaagtgtgggttac 100  Q
    |||||||||||||||||||||||||||||| |  |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
4814976 ttgtttttaggggatttgatcccttggatgatcaggtaattgaagtcgataggtaattgaatttagtttctgtggtcattcaggaggaagtgtgggttac 4814877  T
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtgatagtacttggttcggtagtgttcgtattagtgcttttgtgg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |    
4814876 gctttgattcaggtgttaactttggttttggtggttaattttcttattggtgttggtgatagtacttggttgggtagtgttcgtatcagtgcttttgtag 4814777  T
201 gtttttcttttaggtgttccattatatacgacacctttgctttgtaatttttgtat 256  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
4814776 gtttctcttttaggtgttccattatatacgacacctttgctttgtagtttttgtat 4814721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 4782545 - 4782290
Alignment:
1 ttgtttttaggggatttgatcccttggatgcttggtgagctgaagtctataggtaattgaatttagtttttgtggtcattcaggaggaagtgtgggttac 100  Q
    |||||||||||||||||||||||||||||| |  |  |  ||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||    
4782545 ttgtttttaggggatttgatcccttggatgatcaggtaattgaagtcgataggaaattgaatttagtttctgtggtcattcaggaggaagtgtgggttac 4782446  T
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtgatagtacttggttcggtagtgttcgtattagtgcttttgtgg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |    
4782445 gctttgattcaggtgttaactttggttttggtggttaattttcttattggtgttggtgatagtacttggttaggtagtgttcgtataagtgcttttgtag 4782346  T
201 gtttttcttttaggtgttccattatatacgacacctttgctttgtaatttttgtat 256  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
4782345 gtttctcttttaggtgttccattatatacgacacctttgctttgtagtttttgtat 4782290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 152
Target Start/End: Complemental strand, 36132544 - 36132446
Alignment:
57 ttgaatttagtttttgtggtcattcaggaggaagtgt--gggttacg-ctttgattcaggtgttaactttgattttggtggttaattttcttattggtg 152  Q
    |||| ||| ||||||||||||||||| ||||||||||  |||||||| |||||||| | |||||  |||||||||||||  ||  ||||||||||||||    
36132544 ttgatttttgtttttgtggtcattcatgaggaagtgttggggttacgtctttgatttaagtgttggctttgattttggtaatttgttttcttattggtg 36132446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 18786973 - 18786921
Alignment:
103 tttgattcaggtgttaactttgattttggtggttaattttcttattggtgttg 155  Q
    ||||||| ||||||| |||||||||| |||||||| |||| ||||||||||||    
18786973 tttgatttaggtgttgactttgatttcggtggttattttttttattggtgttg 18786921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 158
Target Start/End: Complemental strand, 17427724 - 17427621
Alignment:
57 ttgaatttagtttttgtggtcattcaggaggaagtgtgggttac-gctttgattcaggtgttaactttgatttt-ggtggttaattttcttattggtgtt 154  Q
    |||||||| |||| ||| |||||||  ||||||||||||| |   | ||||| | | ||||| ||||||||||| |||||||| ||||||||||||||||    
17427724 ttgaattttgtttatgttgtcattcgcgaggaagtgtggggtcttgatttgacttaagtgttgactttgatttttggtggttatttttcttattggtgtt 17427625  T
155 ggtg 158  Q
    ||||    
17427624 ggtg 17427621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 158
Target Start/End: Complemental strand, 21322012 - 21321923
Alignment:
71 tgtggtcattcaggaggaagtgtgggttacg--ctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtg 158  Q
    |||||||||||| |||||||||||||  |    |||||||| |  ||||||||||| ||||||| || | ||||||||||||||||||||    
21322012 tgtggtcattcatgaggaagtgtgggcgattgactttgatttaaatgttaactttggttttggtagtcagttttcttattggtgttggtg 21321923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 31122733 - 31122676
Alignment:
102 ctttgattcaggtgttaactttgattttggtggttaatttt-cttattggtgttggtg 158  Q
    |||||||| ||||||| |||||| |||| ||||||| |||| ||||||||||||||||    
31122733 ctttgatttaggtgttgactttggttttagtggttagttttacttattggtgttggtg 31122676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 157
Target Start/End: Complemental strand, 15676609 - 15676553
Alignment:
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggt 157  Q
    |||||| || ||||||| |||||| ||||| ||||||  ||||||||||||||||||    
15676609 gctttggtttaggtgttgactttggttttgctggttagatttcttattggtgttggt 15676553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 198707 times since January 2019
Visitors: 2774