View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_45 (Length: 249)

Name: NF1429_low_45
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_45
NF1429_low_45
[»] chr5 (1 HSPs)
chr5 (10-249)||(42227607-42227846)


Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 42227607 - 42227846
Alignment:
10 tcataggctaagtgttcgagcataagttaaatgtgaaagcatctaaaactagtttaccttcttcactatcatcaaagagcaactcactatgaacttcatc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
42227607 tcataggctaagtgttcgagcataagttaaatgtgaaagcatctataactagtttaccttcttcactatcatcaaagagcaactcactatgaaattcatc 42227706  T
110 tagattttgagaagtttcacaatgtgcaattgttgcatgcccaattttcccatcatttatcttgattacacttccatcagcaaaactacaatactctaaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42227707 tagattttgagaagtttcacaatgtgcaattgttgcatgcccaattttcccatcatttatcttgattacacttccatcagcaaaactacaatactctaaa 42227806  T
210 tgacgaattttcaccctgcatgatgtgttaggaatgtacc 249  Q
    ||||||||||||||||||||||||||||||||||||||||    
42227807 tgacgaattttcaccctgcatgatgtgttaggaatgtacc 42227846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38200 times since January 2019
Visitors: 1598