View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_47 (Length: 246)

Name: NF1429_low_47
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_47
[»] chr2 (2 HSPs)
chr2 (1-230)||(44267006-44267236)
chr2 (72-149)||(5133655-5133733)
[»] chr6 (2 HSPs)
chr6 (71-104)||(32843423-32843456)
chr6 (72-149)||(33068670-33068747)
[»] chr4 (2 HSPs)
chr4 (71-104)||(9843774-9843807)
chr4 (72-104)||(19422347-19422379)
[»] chr3 (1 HSPs)
chr3 (72-104)||(24158611-24158643)

Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 44267006 - 44267236
1 aaactattttcagcttctctctataagttgttcatgataatttgtgaaaacagtttggctatannnnnnn-attatagaaataacttatacataagcagt 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
44267006 aaactattttcagcttctctctataagttgttcatgataatttgtgaaaacagtttggctatattttttttattatagaaataacttatacataagcagt 44267105  T
100 tatatatgcgcttatgcaatagtaaacatttaattaagttgtttatccaatgtagtcttttatattagaattagagaaatcacactagttttggcaatca 199  Q
44267106 tatatatgcgcttatgcaatagtaaacatttaattaagttgtttatccaatgtagtcttttatattagaattagagaaatcacactagttttggcaatca 44267205  T
200 acacttgccacaaaatgatggaaactggaag 230  Q
44267206 acacttgccacaaaatgatggaaactggaag 44267236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 5133733 - 5133655
72 ttatagaaataacttatacataagcagttat-atatgcgcttatgcaatagtaaacatttaattaagttgtttatccaa 149  Q
    ||||||||||| ||||||||||||||  ||| ||| | |||||||| ||| |||||| ||||||||| |||||||||||    
5133733 ttatagaaatagcttatacataagcaaatatgataagtgcttatgctataataaacacttaattaagctgtttatccaa 5133655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 104
Target Start/End: Original strand, 32843423 - 32843456
71 attatagaaataacttatacataagcagttatat 104  Q
    ||||||||||||||||||||||||||| ||||||    
32843423 attatagaaataacttatacataagcacttatat 32843456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 33068670 - 33068747
72 ttatagaaataacttatacataagcagttat---atatgcgcttatgcaatagtaaacatttaattaagttgtttatccaa 149  Q
    |||||||||||||||||||||||||| ||||   ||| |||||||||| |   |||||| ||||||||| |||| ||||||    
33068670 ttatagaaataacttatacataagcatttatttgataagcgcttatgcta---taaacacttaattaagctgttcatccaa 33068747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 104
Target Start/End: Original strand, 9843774 - 9843807
71 attatagaaataacttatacataagcagttatat 104  Q
    |||||||||||| |||||||||||||||||||||    
9843774 attatagaaatagcttatacataagcagttatat 9843807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 19422379 - 19422347
72 ttatagaaataacttatacataagcagttatat 104  Q
    |||||||||||||||||||||||||| ||||||    
19422379 ttatagaaataacttatacataagcatttatat 19422347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 24158611 - 24158643
72 ttatagaaataacttatacataagcagttatat 104  Q
    |||||||||||||||||||||||||| ||||||    
24158611 ttatagaaataacttatacataagcacttatat 24158643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 38023 times since January 2019
Visitors: 1598