View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_51 (Length: 237)

Name: NF1429_low_51
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_51
NF1429_low_51
[»] chr1 (2 HSPs)
chr1 (1-219)||(46138569-46138787)
chr1 (161-198)||(46140505-46140542)
[»] chr6 (2 HSPs)
chr6 (158-211)||(22339267-22339320)
chr6 (159-201)||(22415984-22416026)


Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 46138787 - 46138569
Alignment:
1 taatcatgagtatctcaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46138787 taatcatgagtatctgaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta 46138688  T
101 aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46138687 aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg 46138588  T
201 gggattgtgttggagtttt 219  Q
    ||||||| |||||||||||    
46138587 gggattgcgttggagtttt 46138569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Complemental strand, 46140542 - 46140505
Alignment:
161 ggagttgaccgtgatcatgagtattgtaatccaacggt 198  Q
    |||||||| |||||| ||||||||||||||||||||||    
46140542 ggagttgatcgtgattatgagtattgtaatccaacggt 46140505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 22339267 - 22339320
Alignment:
158 gttggagttgaccgtgatcatgagtattgtaatccaacggttggggattgtgtt 211  Q
    ||||||||| |||||||| |||||||||||||||||||||| || ||| |||||    
22339267 gttggagttaaccgtgattatgagtattgtaatccaacggtgggagatagtgtt 22339320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 22415984 - 22416026
Alignment:
159 ttggagttgaccgtgatcatgagtattgtaatccaacggttgg 201  Q
    |||||||||| ||| ||||||||||||| ||||||||||||||    
22415984 ttggagttgatcgtaatcatgagtattgcaatccaacggttgg 22416026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125393 times since January 2019
Visitors: 1457