View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_51 (Length: 237)

Name: NF1429_low_51
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_51
[»] chr1 (2 HSPs)
chr1 (1-219)||(46138569-46138787)
chr1 (161-198)||(46140505-46140542)
[»] chr6 (2 HSPs)
chr6 (158-211)||(22339267-22339320)
chr6 (159-201)||(22415984-22416026)

Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 46138787 - 46138569
1 taatcatgagtatctcaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46138787 taatcatgagtatctgaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta 46138688  T
101 aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg 200  Q
46138687 aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg 46138588  T
201 gggattgtgttggagtttt 219  Q
    ||||||| |||||||||||    
46138587 gggattgcgttggagtttt 46138569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Complemental strand, 46140542 - 46140505
161 ggagttgaccgtgatcatgagtattgtaatccaacggt 198  Q
    |||||||| |||||| ||||||||||||||||||||||    
46140542 ggagttgatcgtgattatgagtattgtaatccaacggt 46140505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 22339267 - 22339320
158 gttggagttgaccgtgatcatgagtattgtaatccaacggttggggattgtgtt 211  Q
    ||||||||| |||||||| |||||||||||||||||||||| || ||| |||||    
22339267 gttggagttaaccgtgattatgagtattgtaatccaacggtgggagatagtgtt 22339320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 22415984 - 22416026
159 ttggagttgaccgtgatcatgagtattgtaatccaacggttgg 201  Q
    |||||||||| ||| ||||||||||||| ||||||||||||||    
22415984 ttggagttgatcgtaatcatgagtattgcaatccaacggttgg 22416026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318713 times since January 2019
Visitors: 3039