View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_52 (Length: 237)

Name: NF1429_low_52
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_52
NF1429_low_52
[»] chr7 (3 HSPs)
chr7 (1-221)||(327602-327829)
chr7 (1-217)||(620767-620990)
chr7 (72-204)||(528434-528566)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 327829 - 327602
Alignment:
1 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagc-------cacgcacaggggaggaaagtggtatcgagagaaga 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||| |||||||||||||||||||||||||||||||    
327829 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagcgtgtggtcacacacaggggaggaaagtggtatcgagagaaga 327730  T
94 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
327729 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 327630  T
194 gatgaggcactctataggtcaaggacat 221  Q
    ||||||||||||||||||||||||||||    
327629 gatgaggcactctataggtcaaggacat 327602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 620767 - 620990
Alignment:
1 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagc-------cacgcacaggggaggaaagtggtatcgagagaaga 93  Q
    |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||       ||| |||||||||||||||||||||||||||||||    
620767 tccaactttctgtaaattacttcattttgctgtttcattgctaggtatctccaaaagcgtgtggtcacacacaggggaggaaagtggtatcgagagaaga 620866  T
94 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 193  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
620867 ggcagtcatgcgaatcaaagctgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 620966  T
194 gatgaggcactctataggtcaagg 217  Q
    ||||||||||||||||||||||||    
620967 gatgaggcactctataggtcaagg 620990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 72 - 204
Target Start/End: Original strand, 528434 - 528566
Alignment:
72 ggaaagtggtatcgagagaagaggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccga 171  Q
    |||||||||| |||||||| ||||| || ||| |||| ||||  || |||||||| |||| ||||||||||||||||||||||||||||||||||| |||    
528434 ggaaagtggtgtcgagagaggaggcggttatgagaattaaagcggcagttgatgctagaagtgagagtggatctgatattgtgattgtggctcgcagcga 528533  T
172 tgcgcgccaagccctgtctcttgatgaggcact 204  Q
    ||| ||||||| | |||||||||| ||||||||    
528534 tgcacgccaaggcgtgtctcttgaagaggcact 528566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295276 times since January 2019
Visitors: 3016