View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_54 (Length: 234)

Name: NF1429_low_54
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_54
[»] chr4 (2 HSPs)
chr4 (1-223)||(1159482-1159724)
chr4 (68-100)||(1163612-1163644)

Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1159724 - 1159482
1 cctacagtttataaataaagaagataatttatctcatcttcaagtaataatatgacctatgtcttgcttgggaggtcaattttctcacttttatagtaaa 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||||    
1159724 cctacaatttataaataaagaagataatttatctcatcttcaagtaataagatgac--atgtcttgcttgggaggtcaattttctcacttttatagtaaa 1159627  T
101 gttaaaccctagttgtaacaaac----aaatagagatatacttat------------------tgtataaaaccatttgcaagagatctccactgcacat 178  Q
    |||||||||||||||||||||||    ||||||| |||||  |||                  |||||||||||||||||||||||||||||||||||||    
1159626 gttaaaccctagttgtaacaaacaaacaaatagatatatatatatatatatatatatattttttgtataaaaccatttgcaagagatctccactgcacat 1159527  T
179 atatcagtatcatcattgttggtggttgaaacttagtagtaattg 223  Q
1159526 atatcagtatcatcattgttggtggttgaaacttagtagtaattg 1159482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Complemental strand, 1163644 - 1163612
68 ttgggaggtcaattttctcacttttatagtaaa 100  Q
    |||||||||||||||| ||||||||||||||||    
1163644 ttgggaggtcaattttttcacttttatagtaaa 1163612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175698 times since January 2019
Visitors: 2679