View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_55 (Length: 233)

Name: NF1429_low_55
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_55
NF1429_low_55
[»] chr5 (17 HSPs)
chr5 (1-218)||(42228047-42228258)
chr5 (138-218)||(42228302-42228382)
chr5 (34-110)||(39594848-39594924)
chr5 (58-129)||(10640018-10640089)
chr5 (55-110)||(11064728-11064783)
chr5 (55-129)||(11700224-11700298)
chr5 (42-129)||(12425620-12425709)
chr5 (79-133)||(19460256-19460310)
chr5 (34-93)||(499702-499760)
chr5 (60-107)||(16457935-16457982)
chr5 (55-110)||(41419381-41419436)
chr5 (60-110)||(9107157-9107207)
chr5 (57-110)||(12433126-12433179)
chr5 (34-91)||(39105505-39105562)
chr5 (65-110)||(39248170-39248215)
chr5 (34-98)||(1464985-1465049)
chr5 (55-107)||(29925903-29925955)
[»] chr8 (11 HSPs)
chr8 (34-127)||(32840922-32841015)
chr8 (58-129)||(27028896-27028967)
chr8 (34-96)||(33808344-33808406)
chr8 (65-129)||(30251388-30251452)
chr8 (60-110)||(26771332-26771382)
chr8 (59-100)||(10722689-10722730)
chr8 (65-110)||(28763440-28763485)
chr8 (34-110)||(1930076-1930152)
chr8 (58-129)||(1058011-1058082)
chr8 (72-107)||(26215538-26215573)
chr8 (59-111)||(27754469-27754521)
[»] chr1 (9 HSPs)
chr1 (34-96)||(47498806-47498868)
chr1 (60-110)||(49938814-49938864)
chr1 (60-129)||(2295163-2295232)
chr1 (36-129)||(38001639-38001731)
chr1 (34-110)||(6102195-6102270)
chr1 (34-86)||(38503442-38503494)
chr1 (65-110)||(9572054-9572099)
chr1 (76-129)||(33204328-33204381)
chr1 (60-129)||(50644189-50644258)
[»] chr4 (6 HSPs)
chr4 (65-110)||(21731609-21731654)
chr4 (64-110)||(49940120-49940166)
chr4 (60-109)||(39603124-39603173)
chr4 (60-129)||(54426110-54426179)
chr4 (65-129)||(25904157-25904221)
chr4 (58-110)||(56249588-56249640)
[»] chr7 (8 HSPs)
chr7 (36-100)||(36537951-36538014)
chr7 (68-110)||(19214359-19214401)
chr7 (65-110)||(48470116-48470161)
chr7 (66-129)||(27863659-27863722)
chr7 (37-91)||(87047-87101)
chr7 (34-100)||(20526487-20526553)
chr7 (59-100)||(29574589-29574630)
chr7 (77-129)||(45338537-45338589)
[»] chr3 (6 HSPs)
chr3 (34-110)||(21367708-21367784)
chr3 (35-129)||(402476-402570)
chr3 (65-100)||(34637948-34637983)
chr3 (60-110)||(31365141-31365191)
chr3 (65-110)||(22919-22964)
chr3 (66-110)||(43046738-43046782)
[»] chr2 (8 HSPs)
chr2 (42-110)||(40682348-40682416)
chr2 (60-111)||(24100995-24101046)
chr2 (58-129)||(449912-449983)
chr2 (60-110)||(7035520-7035570)
chr2 (59-100)||(1801733-1801774)
chr2 (60-100)||(23974456-23974496)
chr2 (58-110)||(42419858-42419910)
chr2 (34-110)||(42457989-42458065)
[»] scaffold0024 (1 HSPs)
scaffold0024 (34-99)||(27617-27681)
[»] scaffold0057 (1 HSPs)
scaffold0057 (58-110)||(24686-24738)
[»] chr6 (1 HSPs)
chr6 (34-110)||(2455300-2455376)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 42228047 - 42228258
Alignment:
1 catatttgaagcttatagcacaagcgctgacgtataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42228047 catatttgaagcttatagcacaagcgctgacgtataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 42228146  T
101 gaaacttatgagagtggataacctcaaatgagcgaactaaaagcttgaatttttacaagaatttccatcaacccattacaatgcgaccaattgggtagct 200  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||     ||||||||| |||||    
42228147 gaaacttatgagagtggataacctcaaatgag-gaactaaaagcttgaatttttacaagaatttccatcaacccattaca-----accaattggttagct 42228240  T
201 aaatttgaactcaattat 218  Q
    ||||||||||||||||||    
42228241 aaatttgaactcaattat 42228258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 138 - 218
Target Start/End: Original strand, 42228302 - 42228382
Alignment:
138 taaaagcttgaatttttacaagaatttccatcaacccattacaatgcgaccaattgggtagctaaatttgaactcaattat 218  Q
    |||||||||||||||||||| ||| |||||||||||||||||||| | |||||||||||| ||||||| |||||| |||||    
42228302 taaaagcttgaatttttacacgaacttccatcaacccattacaattcaaccaattgggtatctaaattagaactcgattat 42228382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 39594848 - 39594924
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||| ||||| | |||| |||||||| |||||||| ||||||||||||| || |||||||||    
39594848 ataagctgaaaacaacttaataacattatcttcagctgttttcataagttgtcccaaacaatctaacaaaacttatg 39594924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 10640018 - 10640089
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| |||||||||||||||||||| |||| |||||||||  ||| ||||| |||||||    
10640018 aatgtcataagctgttttcataagttctcccaaacaatatcacaaaacttatgtcagtagataaactcaaat 10640089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 11064728 - 11064783
Alignment:
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||| |||||||||    
11064728 aacaatgtcataagctattttcataagttctctcaaacaatctcacaaaacttatg 11064783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 11700224 - 11700298
Alignment:
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||| |||| ||||||||||||||||   ||||| |||||| |||||||||  ||||||||| |||||||    
11700224 aacaatgtcataagttgtttccataagttctgtgaaacagtctcacaaaacttatgccagtggataagctcaaat 11700298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 129
Target Start/End: Original strand, 12425620 - 12425709
Alignment:
42 aaaacaacttactaacaatgtcttaagctgtttccata--agttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||||| | ||||||| ||| | ||||| ||||  |||||||||||||| |||||| |||||||||| ||| ||||| |||||||    
12425620 aaaacaacttattgacaatgttttaggttgttttcatataagttctcccaaacagtctcacaaaacttatgacagtagataagctcaaat 12425709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 79 - 133
Target Start/End: Complemental strand, 19460310 - 19460256
Alignment:
79 aagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaatgagc 133  Q
    |||||||||||||||||||||| |||||||||  ||| ||||| |||||||||||    
19460310 aagttctcccaaacaatctcactaaacttatgccagtagataaactcaaatgagc 19460256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 93
Target Start/End: Complemental strand, 499760 - 499702
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaaca 93  Q
    ||||||| ||||||||||  ||||| |||| |||||||||| ||||||||||||||||||    
499760 ataagctgaaaacaacttgttaaca-tgtcataagctgttttcataagttctcccaaaca 499702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 16457982 - 16457935
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaactt 107  Q
    |||| |||||||||| |||||||||||||||||| |||||| ||||||    
16457982 tgtcataagctgttttcataagttctcccaaacagtctcacaaaactt 16457935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 41419381 - 41419436
Alignment:
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||||||| || ||||| |||||||||||||||| ||| |||||    
41419381 aacaatgtcataagctgttttcacaagttatcccaaacaatctcacaaaatttatg 41419436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 9107157 - 9107207
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| ||| |||||||||||||| |||||| |||||||||    
9107157 tgtcctaagctgttttcatgagttctcccaaacattctcacaaaacttatg 9107207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 12433179 - 12433126
Alignment:
57 caatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| ||| ||||| ||||||||||||||||||| |||| ||||    
12433179 caatgtcgtaagctattttcataacttctcccaaacaatctcacaaaacctatg 12433126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 91
Target Start/End: Original strand, 39105505 - 39105562
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaa 91  Q
    |||||||||||| | ||||  ||||||||| |||||||||| ||||| ||||||||||    
39105505 ataagctaaaaatagcttatgaacaatgtcataagctgttttcataaattctcccaaa 39105562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 39248170 - 39248215
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||||  ||||||||||||||||| |||||| |||||||||    
39248170 taagctgtttttataagttctcccaaacagtctcacaaaacttatg 39248215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 98
Target Start/End: Complemental strand, 1465049 - 1464985
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctc 98  Q
    ||||||| |||||||||||  | ||||| | |||||||||| ||||||||||||| |||| ||||    
1465049 ataagctgaaaacaacttatgagcaatgccataagctgttttcataagttctcccgaacagtctc 1464985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 29925903 - 29925955
Alignment:
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaactt 107  Q
    |||| |||| |||||||||| |||||||||||||||||  |||||| ||||||    
29925903 aacattgtcataagctgttttcataagttctcccaaacggtctcacaaaactt 29925955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 11)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 34 - 127
Target Start/End: Complemental strand, 32841015 - 32840922
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaa 127  Q
    ||||||| |||||||||||  ||||||||| |||| ||||| |||||||||||||||||| |||| | |||||| || |||| ||||| |||||    
32841015 ataagctgaaaacaacttatgaacaatgtcataagttgttttcataagttctcccaaacagtctcgcaaaacttgtgtgagtagataagctcaa 32840922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 27028896 - 27028967
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| || || ||||||||||||||||||| |||||||||  ||||||||| |||||||    
27028896 aatgtcctaagctgttttcagaatttctcccaaacaatctcactaaacttatgccagtggataaactcaaat 27028967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 33808344 - 33808406
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatc 96  Q
    |||||||||||||||||||  |||||| || |||||| ||| |||||||||||||||||||||    
33808344 ataagctaaaaacaacttatgaacaatatcataagctattttcataagttctcccaaacaatc 33808406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 30251452 - 30251388
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||| | |||||||||||||||| ||||||||||||||||  ||| ||||| |||||||    
30251452 taagctgttttcgtaagttctcccaaacagtctcacgaaacttatgtcagtagataagctcaaat 30251388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 26771332 - 26771382
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| |||||||||||||||||| |||||| |||||||||    
26771332 tgtcataagctgttttcataagttctcccaaacagtctcacaaaacttatg 26771382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 10722689 - 10722730
Alignment:
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| |||||||||||||||| |||||||||||||||||||    
10722689 atgtcataagctgtttccataaattctcccaaacaatctcac 10722730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 28763440 - 28763485
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| |||||||||||||||||| |||||| |||||||||    
28763440 taagctgttttcataagttctcccaaacagtctcacaaaacttatg 28763485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 1930076 - 1930152
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| ||||  ||||||||| ||| |||||| || ||||||||||||| ||| |||| |||||||||    
1930076 ataagctgaaaacagcttatgaacaatgtcataaactgttttcacaagttctcccaaataatgtcacaaaacttatg 1930152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 1058082 - 1058011
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| ||||| |||| || ||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
1058082 aatgtcataagcagttttcaaaagttctcccaaacagtctcacaaaacttatgtaagtagataagctcaaat 1058011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 107
Target Start/End: Original strand, 26215538 - 26215573
Alignment:
72 tttccataagttctcccaaacaatctcacgaaactt 107  Q
    ||||||||||||||||||||||||||||| ||||||    
26215538 tttccataagttctcccaaacaatctcacaaaactt 26215573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 111
Target Start/End: Original strand, 27754469 - 27754521
Alignment:
59 atgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatga 111  Q
    ||||| ||| |||||| |||||||||||||||| | |||||| ||||||||||    
27754469 atgtcataaactgttttcataagttctcccaaatagtctcacaaaacttatga 27754521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 47498868 - 47498806
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatc 96  Q
    |||||||||||||||||||  |||||| || |||||| ||| |||||||||||||||||||||    
47498868 ataagctaaaaacaacttatgaacaatatcataagctattttcataagttctcccaaacaatc 47498806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 49938814 - 49938864
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| ||||||||||||||||||||||||| |||||||||    
49938814 tgtcataagctgttttcataagttctcccaaacaatctcacaaaacttatg 49938864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 129
Target Start/End: Original strand, 2295163 - 2295232
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||||||||| |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
2295163 tgtcataagctgttttcataagttctcccaaacagtctcacaaaacttatgccagtagataagctcaaat 2295232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 129
Target Start/End: Original strand, 38001639 - 38001731
Alignment:
36 aagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||| |||||||||||  ||||  ||| |||||||||| |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
38001639 aagctgaaaacaacttatgaacag-gtcataagctgttttcataagttctcccaaacagtctcacaaaacttatgtcagttgataaactcaaat 38001731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 6102195 - 6102270
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||| |||  |||||| || |||||||||| |||| |||||||||||||||||||| ||| |||||    
6102195 ataagctgaaaacaatttatgaacaatatcataagctgttttcata-gttctcccaaacaatctcacaaaatttatg 6102270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 38503494 - 38503442
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctc 86  Q
    ||||||| |||||||||||  ||||||||| || |||||||||||||||||||    
38503494 ataagctgaaaacaacttatgaacaatgtcataggctgtttccataagttctc 38503442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 9572099 - 9572054
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| |||||||||||||||||| |||||| || ||||||    
9572099 taagctgttttcataagttctcccaaacagtctcacaaatcttatg 9572054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 76 - 129
Target Start/End: Complemental strand, 33204381 - 33204328
Alignment:
76 cataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
33204381 cataagttctcccaaacagtctcacaaaacttatgtcagtagataagctcaaat 33204328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 129
Target Start/End: Complemental strand, 50644258 - 50644189
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||| ||||| |||||||||||||||||| |||||| |||| ||||  ||| ||||| |||||||    
50644258 tgtcgtaagttgttttcataagttctcccaaacagtctcacaaaacatatgttagtagataagctcaaat 50644189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 21731654 - 21731609
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||    
21731654 taagctgttttcataagttctcccaaacaatctcacaaaacttatg 21731609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Complemental strand, 49940166 - 49940120
Alignment:
64 ttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||||| ||||||||||| |||||| |||||| |||||||||    
49940166 ttaagctgttttcataagttctctcaaacagtctcacaaaacttatg 49940120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 109
Target Start/End: Complemental strand, 39603173 - 39603124
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttat 109  Q
    |||| |||||||||| | |||||||||||||||| |||||| ||||||||    
39603173 tgtcataagctgttttcctaagttctcccaaacagtctcacaaaacttat 39603124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 129
Target Start/End: Original strand, 54426110 - 54426179
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||||||||| | ||||||||||||| || |||||| |||||||||  ||| ||||| |||||||    
54426110 tgtcataagctgttttcctaagttctcccaagcagtctcacaaaacttatgccagtagataagctcaaat 54426179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 25904221 - 25904157
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||| |||||| ||||||||||| |||||| ||| |||||  | ||||||| |||||||    
25904221 taagctgttttcataagctctcccaaacagtctcacaaaatttatgtcattggataagctcaaat 25904157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 56249588 - 56249640
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| ||||||||||  ||||||| | |||||||||||||| |||||||||    
56249588 aatgtcataagctgttttgataagttgttccaaacaatctcacaaaacttatg 56249640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 100
Target Start/End: Original strand, 36537951 - 36538014
Alignment:
36 aagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||||||||||  |||| |||| |||| ||||||||||||||||| |||||||||||||    
36537951 aagctaaaaacaacttatgaaca-tgtcataagttgtttccataagttctctcaaacaatctcac 36538014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 68 - 110
Target Start/End: Complemental strand, 19214401 - 19214359
Alignment:
68 gctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||||||||||||||||| |||||||||    
19214401 gctgttttcataagttctcccaaacaatctcacaaaacttatg 19214359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 48470116 - 48470161
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||||||||||||||||||||||  |||||||||    
48470116 taagctgttttcataagttctcccaaacaatctcataaaacttatg 48470161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 27863722 - 27863659
Alignment:
66 aagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||| ||||||||||| |||| | |||||| |||||||||  ||||||||| |||||||    
27863722 aagctgttttcataagttctctcaaatagtctcacaaaacttatgccagtggataagctcaaat 27863659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Original strand, 87047 - 87101
Alignment:
37 agctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaa 91  Q
    |||| ||||||||||||||||||| || |||||| ||||  ||||||||||||||    
87047 agctgaaaacaacttactaacaatatcataagctttttctgtaagttctcccaaa 87101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 20526487 - 20526553
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||||||| ||||| || |||||  ||| |||||| ||||||||||| |||||| ||||||    
20526487 ataagctaaaaacagcttacgaaaaatgtgataaactgttttcataagttctctcaaacagtctcac 20526553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 100
Target Start/End: Complemental strand, 29574630 - 29574589
Alignment:
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| ||||||||||||||||||||||| ||||| ||||||    
29574630 atgtcataagctgtttccataagttctccgaaacagtctcac 29574589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 45338537 - 45338589
Alignment:
77 ataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||||||||||| |||||  |||||||||  ||||||||| |||||||    
45338537 ataagttctcccaaacagtctcaaaaaacttatgctagtggataaactcaaat 45338589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 21367708 - 21367784
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| |||   ||||||||| |||||||||| |||||||||||||||||| || ||| |||||||||    
21367708 ataagctgaaaacagcttgtgaacaatgtcataagctgttttcataagttctcccaaacagtcccacaaaacttatg 21367784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 402570 - 402476
Alignment:
35 taagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||| ||||  ||||||||| |||||||||| |||| ||||||||||||| |||  | |||||||||  ||| ||||| |||||||    
402570 taagctgaaaacagcttatgaacaatgtcataagctgttttcatacgttctcccaaacagtcttgcaaaacttatgttagttgataaactcaaat 402476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 100
Target Start/End: Complemental strand, 34637983 - 34637948
Alignment:
65 taagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||| |||||||||||||||||||||||||    
34637983 taagctgttttcataagttctcccaaacaatctcac 34637948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Complemental strand, 31365191 - 31365141
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| ||||||| || |||||||||||||||||| |||||| |||||||||    
31365191 tgtcataagctgctttcataagttctcccaaacagtctcacaaaacttatg 31365141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 22964 - 22919
Alignment:
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||| |||||| |||||||||||| |||||||||    
22964 taagctgttttcataacttctcctaaacaatctcacaaaacttatg 22919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 43046738 - 43046782
Alignment:
66 aagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||||||||||||||| |||||| |||| ||||    
43046738 aagctgttttcataagttctcccaaacagtctcacaaaacatatg 43046782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 40682416 - 40682348
Alignment:
42 aaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||||  ||||||||| |||||| |||  | |||||||||||||||||||||| |||||||||    
40682416 aaaacaacttatgaacaatgtcataagctattttaacaagttctcccaaacaatctcacaaaacttatg 40682348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 111
Target Start/End: Original strand, 24100995 - 24101046
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatga 111  Q
    |||| |||| |||||||||||||||||||||||| |||||| ||||||||||    
24100995 tgtcataaggtgtttccataagttctcccaaacagtctcacaaaacttatga 24101046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 449912 - 449983
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| || |||| ||||||||||||||||  |||||||||  ||| ||||| |||||||    
449912 aatgtcataagctgttttcaaaagtcctcccaaacaatctcataaaacttatgctagtagataagctcaaat 449983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Complemental strand, 7035570 - 7035520
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| ||||||||||||||||||||| | ||||| |||||| |||||||||    
7035570 tgtcataagctgtttccataagttcttcaaaacagtctcacaaaacttatg 7035520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 1801733 - 1801774
Alignment:
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| |||||||||| |||||||||||||||||||| ||||    
1801733 atgtcataagctgttttcataagttctcccaaacaatatcac 1801774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 100
Target Start/End: Complemental strand, 23974496 - 23974456
Alignment:
60 tgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||| |||||||||| |||||||||||| ||||||||||||    
23974496 tgtcataagctgttttcataagttctccaaaacaatctcac 23974456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 42419858 - 42419910
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| |||||||||| | |||||||||||||||| |||||  |||||||||    
42419858 aatgtcataagctgttttcgtaagttctcccaaacagtctcaaaaaacttatg 42419910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 42457989 - 42458065
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||| | | ||||| ||||| ||||| |||||  ||||| ||||| |||||| |||||||||    
42457989 ataagctgaaaacaacttattgaaaatgttttaagttgttttcataaactctcctaaacactctcacaaaacttatg 42458065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 99
Target Start/End: Original strand, 27617 - 27681
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctca 99  Q
    ||||||| ||||||||||| || | ||||| |||||| |||||||||| ||||||||||| |||||    
27617 ataagctgaaaacaactta-tagccatgtcataagctatttccataagctctcccaaacagtctca 27681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 24686 - 24738
Alignment:
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| ||||||||||  ||||||||||||||||| |||||| |||| ||||    
24686 aatgtcataagctgttttgataagttctcccaaacagtctcacaaaacatatg 24738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 2455300 - 2455376
Alignment:
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||||||||  ||||||||  |||| ||||| ||||||||||| |||| | | |||| |||||||||    
2455300 ataagctgaaaacaacttataaacaatgtaataagttgttttcataagttctctcaaatagtttcaccaaacttatg 2455376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 29946 times since January 2019
Visitors: 1588