View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_58 (Length: 223)

Name: NF1429_low_58
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_58
NF1429_low_58
[»] chr6 (1 HSPs)
chr6 (1-207)||(778389-778595)


Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 778595 - 778389
Alignment:
1 tctaaaagaatccatttttggatttgaaatgaagaaaggtgaagattttccaacagtttggaagaaagaagaagatggacatgcaaatccatcaatggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
778595 tctaaaagaatccatttttggatttgaaatgaagaaaggtgaagattttccaacagtttggaagaaagaagaagatggacatgcaaatccatcaatggtg 778496  T
101 agtctaagtggtgaagaagaaaaattgtgagaatgagaattttgaaaagggtgaaattttggtttggttatgtggtttgaaagatgtaaggttgaagaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
778495 agtctaagtggtgaagaagaaaaattgtgagaatgagaattttgaaaagggtgaaattttggtttggttatgtggtttgaaagatgtaaggttgaagaag 778396  T
201 aaggtga 207  Q
    |||||||    
778395 aaggtga 778389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 30765 times since January 2019
Visitors: 1588