View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565-INSERTION-1 (Length: 700)

Name: NF1565-INSERTION-1
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565-INSERTION-1
NF1565-INSERTION-1
[»] chr3 (7 HSPs)
chr3 (227-699)||(42793902-42794374)
chr3 (227-699)||(46427972-46428444)
chr3 (227-699)||(54812559-54813031)
chr3 (476-700)||(43912562-43912791)
chr3 (237-502)||(27156674-27156939)
chr3 (237-394)||(54346161-54346318)
chr3 (606-679)||(54346530-54346603)
[»] chr6 (6 HSPs)
chr6 (227-699)||(1223273-1223744)
chr6 (7-174)||(898144-898311)
chr6 (111-171)||(1194549-1194609)
chr6 (195-229)||(898092-898126)
chr6 (111-171)||(1183793-1183853)
chr6 (252-295)||(26207961-26208004)
[»] chr7 (13 HSPs)
chr7 (227-688)||(24472864-24473325)
chr7 (591-677)||(24472654-24472740)
chr7 (237-394)||(8020360-8020517)
chr7 (237-394)||(29214344-29214501)
chr7 (548-679)||(29214059-29214190)
chr7 (227-328)||(31047546-31047647)
chr7 (599-679)||(28395677-28395757)
chr7 (237-394)||(25712892-25713049)
chr7 (606-679)||(25713261-25713334)
chr7 (240-322)||(38111362-38111444)
chr7 (606-679)||(8020075-8020148)
chr7 (606-679)||(48618729-48618802)
chr7 (252-300)||(45753388-45753436)
[»] chr8 (4 HSPs)
chr8 (227-699)||(44145135-44145593)
chr8 (237-394)||(26617340-26617497)
chr8 (616-674)||(38560904-38560962)
chr8 (606-676)||(1635793-1635863)
[»] chr1 (10 HSPs)
chr1 (327-699)||(22065512-22065885)
chr1 (237-394)||(5308068-5308225)
chr1 (237-394)||(23949124-23949281)
chr1 (237-394)||(23085527-23085684)
chr1 (237-394)||(23722713-23722870)
chr1 (274-394)||(50953184-50953304)
chr1 (606-679)||(23085242-23085315)
chr1 (606-679)||(5308437-5308510)
chr1 (606-679)||(23949493-23949566)
chr1 (606-679)||(50952899-50952972)
[»] chr5 (4 HSPs)
chr5 (227-699)||(18882796-18883268)
chr5 (555-687)||(4560637-4560769)
chr5 (548-679)||(34081069-34081200)
chr5 (240-322)||(14024272-14024354)
[»] chr4 (5 HSPs)
chr4 (482-699)||(47597901-47598118)
chr4 (237-394)||(36895032-36895189)
chr4 (237-394)||(34390421-34390578)
chr4 (240-322)||(1368771-1368853)
chr4 (605-679)||(34390136-34390210)
[»] chr2 (6 HSPs)
chr2 (237-503)||(40196893-40197159)
chr2 (237-394)||(7305697-7305854)
chr2 (275-622)||(26381659-26382006)
chr2 (234-320)||(42161748-42161834)
chr2 (627-679)||(7305413-7305465)
chr2 (548-680)||(40196717-40196849)
[»] scaffold0003 (1 HSPs)
scaffold0003 (612-700)||(355705-355793)


Alignment Details
Target: chr3 (Bit Score: 441; Significance: 0; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 441; E-Value: 0
Query Start/End: Original strand, 227 - 699
Target Start/End: Original strand, 42793902 - 42794374
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    |||||||||||| | | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42793902 tgttgggatttcccttgcttgcccatgttgtgggaatgatgatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 42794001  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
42794002 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttctccaataaccttaagagaaaaatggttgggataagcacatcta 42794101  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
42794102 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatatttgaagcggatttccaaaggccgaataatccaaatat 42794201  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
42794202 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacgcacactatctacataggatggaaacga 42794301  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42794302 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 42794374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 441; E-Value: 0
Query Start/End: Original strand, 227 - 699
Target Start/End: Original strand, 46427972 - 46428444
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    ||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46427972 tgttgggatttctccgacttgcccatgttgtgggaatgatgattaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 46428071  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
46428072 attgttccttccgactttataactaacttcttttcctttgattgtggggattggttttccaataaccttaagagaaaaatggttgggacaaacacatcta 46428171  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46428172 gatggcagaccacctttatgactatgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 46428271  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
46428272 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacagacactatctacataggatggaaacga 46428371  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46428372 cctcaggaaggttgaatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 46428444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 441; E-Value: 0
Query Start/End: Original strand, 227 - 699
Target Start/End: Complemental strand, 54813031 - 54812559
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54813031 tgttgggatttctcctacttgcccatgttgtgggaatgatgatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 54812932  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
54812931 attgttccttccaacgttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatgta 54812832  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54812831 gatggcagaccacctttatgactacgtgttgatatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 54812732  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
54812731 actaatccaaacattcgttagagatattgaagactacaacttggagctctttcatagagggcctaagttgacggacactatctacataggatggaaacga 54812632  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
54812631 cctcaggaaggttggatcaagctcaacggcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 54812559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 138; E-Value: 9e-72
Query Start/End: Original strand, 476 - 700
Target Start/End: Complemental strand, 43912791 - 43912562
Alignment:
476 gaacaagactatctttgaagcggatttccaaaggccgaataatccaaatatactaatccaaacattcgttagagatattgaagactacaacttggagcac 575  Q
    |||||| |||||||||||||  |||||| |||||| ||| |||| ||||||| ||||||||| ||||||||| |||||||||||||||||||||||| ||    
43912791 gaacaaaactatctttgaagttgatttctaaaggctgaacaatctaaatatattaatccaaagattcgttagggatattgaagactacaacttggagtac 43912692  T
576 tttcatagagggcctaaggtgacggac-----actatctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaa 670  Q
     ||||||||||||||||||||| |||      |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||    
43912691 cttcatagagggcctaaggtgaaggaagtaatactatctacataggatggaaacgacctcagaaaggttggatcaagctcaacagtgacgatgcctgcaa 43912592  T
671 ggatatgggtcatatttccggttgtggtga 700  Q
    ||||||||||||||||| ||||||||||||    
43912591 ggatatgggtcatattttcggttgtggtga 43912562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 71; E-Value: 9e-32
Query Start/End: Original strand, 237 - 502
Target Start/End: Complemental strand, 27156939 - 27156674
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||||||| |||||||||||||| ||||||||  | || || |||||||||||| | || ||||| |    
27156939 tctcctacttgcccgtgttgtggaaatgaagatgaaactgttcttcatgtgcttcgcgattgcatctacgctacccaggtatggctttacatcgttccat 27156840  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaa-gagaaaaatggttgggacaagcacatctagatggcaga 435  Q
      || ||||||||||| |||||||| |||||||| ||||||||||| | ||||||||| ||  ||||| ||  ||||||| | ||| |  || ||| |||    
27156839 atgattttataactaatttcttttcttttgattgcagggattggttcttcaataacctcaacaagaaagat-attgggacgaacactttaagttggaaga 27156741  T
436 ccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggattt 502  Q
      || || ||||| || |||||||| |||||||| |||||||| || ||||| |||||||| |||||    
27156740 taactttcatgacgacatgttggtacttgtggaagtggaggaataaaactatttttgaagctgattt 27156674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 237 - 394
Target Start/End: Original strand, 54346161 - 54346318
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    ||||||| |||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||| || || || |||||||||||| | || ||||| |    
54346161 tctcctaattgcccgtgttgtggaaatgaagatgaaactgttcttcatgtgcttcgcgattgcatccacgctacccaggtatggctttacatcgttccat 54346260  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| ||  |||| ||||||||||| | |||||||||    
54346261 atgattttataactaatttcttttctttcaattgcagggattggttcttcaataacct 54346318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Original strand, 54346530 - 54346603
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
54346530 atctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 54346603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 425; Significance: 0; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 227 - 699
Target Start/End: Complemental strand, 1223744 - 1223273
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
1223744 tgttgggatttctcctacttgcccatgttgtggaaatgatgatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcatgtatggcttcat 1223645  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
1223644 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaatgaccttaagagaaaaatggttgggacaagcacatcta 1223545  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1223544 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 1223445  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    ||||| ||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||    
1223444 actaa-ccaaacatttgttagagatattgaagactacaacctggagctctttcatagagggcctaaggttacagacactatctacataggatggaaacga 1223346  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
1223345 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccgattgtggtg 1223273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 164; E-Value: 3e-87
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 898311 - 898144
Alignment:
7 agctgagtatagagggtttcaaaattaagagtgctacattttgtttttgatcccaagagaatatcaactatcgatgagttgaacaatgcctttagttttg 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
898311 agctgagtatagagggtttcaaaattaagagtgctacattttgtttttgatcccaacagaatatcaactatcgatgagttgaacaatgcctttagttttg 898212  T
107 ggtatagcgaaagagggatcatcaaaatttaccctcactagtgcattgcaagactttttgaatgtccc 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
898211 ggtatagcgaaagagggatcatcaaaatttaccctcactagtgcattgcaagactttttgaatgtccc 898144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 1194609 - 1194549
Alignment:
111 tagcgaaagagggatcatcaaaatttaccctcactagtgcattgcaagactttttgaatgt 171  Q
    |||| |||||||||||||||||||||||||| |||||||||||| || |||||||||||||    
1194609 tagcaaaagagggatcatcaaaatttaccctgactagtgcattggaaaactttttgaatgt 1194549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 229
Target Start/End: Complemental strand, 898126 - 898092
Alignment:
195 tcaactttgacatcaaagtaaaaagaatcagttgt 229  Q
    |||||||||||||||||||||||||||||||||||    
898126 tcaactttgacatcaaagtaaaaagaatcagttgt 898092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 1183853 - 1183793
Alignment:
111 tagcgaaagagggatcatcaaaatttaccctcactagtgcattgcaagactttttgaatgt 171  Q
    |||| ||||||||||||| |||||||| ||| |||| ||||||| || |||||||||||||    
1183853 tagcaaaagagggatcatgaaaatttaacctgactaatgcattggaaaactttttgaatgt 1183793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 26207961 - 26208004
Alignment:
252 tgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtga 295  Q
    |||||||||||||  ||||| |||||||||||||||||||||||    
26207961 tgttgtgggaatgcagatgagactgtccttcatgtgcttcgtga 26208004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 422; Significance: 0; HSPs: 13)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 227 - 688
Target Start/End: Original strand, 24472864 - 24473325
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
24472864 tgtttggatttctcctacttgcccatgttgtgggaatgatgatgaaactgtccttcacgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 24472963  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24472964 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 24473063  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
24473064 gatggcataccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatatttgaagcggatttccaaaggccgaataatccaaatat 24473163  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |    
24473164 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacattatctacataggatggaaacaa 24473263  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttc 688  Q
    ||||||||  |||||||||||||||||||||||| |||||||||||||||||||||||||||    
24473264 cctcaggatagttggatcaagctcaacagcgacgatgcctgcaaggatatgggtcatatttc 24473325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 9e-32
Query Start/End: Original strand, 591 - 677
Target Start/End: Complemental strand, 24472740 - 24472654
Alignment:
591 aaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatg 677  Q
    ||||||||||||| |||||||||||||||||||| |||||||||  |||||||||||||||||||||||||||||||||||||||||    
24472740 aaggtgacggacattatctacataggatggaaacaacctcaggatagttggatcaagctcaacagcgacggtgcctgcaaggatatg 24472654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 8020517 - 8020360
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    ||||||| |||||| | |||||| ||||| ||||||||||| |||||||||||||| |||||||| || || || |||||||||||| | || ||||| |    
8020517 tctcctaattgcccgtattgtggaaatgaagatgaaactgttcttcatgtgcttcgcgattgcatccacgctacccaggtatggctttacatcgttccat 8020418  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| ||  |||| ||||||||||| | |||||||||    
8020417 atgattttataactaatttcttttctttcaattgcagggattggttcttcaataacct 8020360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 29214501 - 29214344
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||  |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || |||||||||||| || | |  |||||||    
29214501 tctcctacttgcctgtgttgtggaaatgaagatgaaactgttcttcatgtgcttcgtgattgcatccacgctactcaggtatggatttacaccgttcctt 29214402  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
    |  | ||||||||||| |  ||||| ||  |||  ||||||||||| | |||||||||    
29214401 ctaattttataactaattgtttttctttcaattacagggattggttcttcaataacct 29214344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 548 - 679
Target Start/End: Complemental strand, 29214190 - 29214059
Alignment:
548 agatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaag 647  Q
    ||||||||||||||  || |||||||| |||||||  || || ||| ||| ||| | |||||| ||||| ||||| ||  |||| |||||||||||||||    
29214190 agatattgaagactgtaatttggagcattttcatattggtccaaagttgaaggaaattatctatataggttggaagcggtctcatgaaggttggatcaag 29214091  T
648 ctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| || || ||||| |||||| |||||||    
29214090 ctcaatagtgatggtgcttgcaagaatatggg 29214059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 227 - 328
Target Start/End: Original strand, 31047546 - 31047647
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    |||||||||||| || ||||  | ||||||||| ||||| ||||||| ||| ||||||||||| | | |||||||||||| ||||| |||||  ||||||    
31047546 tgttgggatttcacccacttatcaatgttgtggtaatgatgatgaaattgttcttcatgtgctccataattgcattcatgtaactcgggtataacttcat 31047645  T
327 at 328  Q
    ||    
31047646 at 31047647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 599 - 679
Target Start/End: Complemental strand, 28395757 - 28395677
Alignment:
599 ggacactatctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| |||||||||| ||||||| | ||| || |||||||||||||||||||| || || || || ||||||||||||||    
28395757 ggacattatctacatatgatggaagcaaccacaagaaggttggatcaagctcaatagtgatggcgcatgcaaggatatggg 28395677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 237 - 394
Target Start/End: Original strand, 25712892 - 25713049
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||| |||  ||||| | ||||| |||||||| || ||| ||||| ||||||||| ||| ||  |||||||| |||||||| | || |||||||    
25712892 tctcctactttcccgagttgtcgaaatgaagatgaaaccgttcttaatgtgattcgtgattccatccacacaactcagatatggctttacatcgttcctt 25712991  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||| | | || ||||| |  ||||| ||||||||||| | |||||||||    
25712992 atgattttataaattatttattttcttccgattgcagggattggttcttcaataacct 25713049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 606 - 679
Target Start/End: Original strand, 25713261 - 25713334
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||| ||||||||||||||||||||||| || | ||| |||||||| |||||    
25713261 atctatataggttggaagcggcctcaagaaggttggatcaagctcaacagtgatgatgcttgcaaggacatggg 25713334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 240 - 322
Target Start/End: Complemental strand, 38111444 - 38111362
Alignment:
240 cctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggct 322  Q
    |||||||| || ||||||| ||  ||||||||||| ||| ||||||| |||||||||||  | || || ||||||||||||||    
38111444 cctacttgtccttgttgtgcgagagaggatgaaacagtcattcatgtccttcgtgattgtgtgcacgctactcaggtatggct 38111362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Complemental strand, 8020148 - 8020075
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
8020148 atctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 8020075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Original strand, 48618729 - 48618802
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||| ||||||||||||||||| || || || ||||| ||||||| ||||||    
48618729 atctatataggttggaagcggcctcaagaaggttggatcaagcttaatagtgatggtgcttgcaaggttatggg 48618802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 252 - 300
Target Start/End: Complemental strand, 45753436 - 45753388
Alignment:
252 tgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgca 300  Q
    |||||||| ||||  || |||||||| ||||||||||||||||||||||    
45753436 tgttgtggaaatgccgacgaaactgttcttcatgtgcttcgtgattgca 45753388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 394; Significance: 0; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 227 - 699
Target Start/End: Original strand, 44145135 - 44145593
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
44145135 tgttgggatttctccaacttgcccatgttgtgggaatgatgatgaaattgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 44145234  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||    
44145235 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaatatggttgggacaagcacattta 44145334  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||                
44145335 gatggcataccacctttatgactacgtgttgttatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaa------------ 44145422  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
      ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
44145423 --taatccaaacattcgttagagatattgaagactacaacttggagctctttcatagagggcctaaggtgacggacactatctacataggatggaaacga 44145520  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44145521 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 44145593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 26617497 - 26617340
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||||| | |||||||||||||| | ||||||  |||| ||||||||||||||| | || ||||| |    
26617497 tctcctacttgcccgtgttgtggaaatgaagatgaaactattcttcatgtgcttcgcggttgcatctatgctactcaggtatggctttacatcgttccat 26617398  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| || ||||| | ||||||||| | |||||||||    
26617397 atgattttataactaatttcttttctttcgattgcatggattggttcttcaataacct 26617340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 616 - 674
Target Start/End: Complemental strand, 38560962 - 38560904
Alignment:
616 gatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggat 674  Q
    ||||| ||| ||||||||||||||||||||| |||| ||| ||||||||||||||||||    
38560962 gatggtaacaacctcaggaaggttggatcaaactcagcagtgacggtgcctgcaaggat 38560904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 676
Target Start/End: Original strand, 1635793 - 1635863
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatat 676  Q
    ||||| ||||| ||||| || ||||| ||||||||||||||||| || || || ||||| |||||||||||    
1635793 atctatataggttggaagcggcctcaagaaggttggatcaagcttaatagtgatggtgcttgcaaggatat 1635863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 327 - 699
Target Start/End: Complemental strand, 22065885 - 22065512
Alignment:
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22065885 attgttcctttcgactttataactaacttcttttcctttgattgcagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 22065786  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatcc-aaata 525  Q
    |||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
22065785 gatgacataccacctttatgactatgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaaata 22065686  T
526 tactaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacg 625  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||    
22065685 tactaatccaaacattcgttagagatattgaagactacaacttggagctctttcatagagggcctaaggtgacgaacactatctacataggatggaaacg 22065586  T
626 acctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
22065585 acctcaggaaggttggatcaagctcaacagtgacggtgcctgcaaggatatgggtcatattttcggttgtggtg 22065512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 237 - 394
Target Start/End: Original strand, 5308068 - 5308225
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||| ||| |||||||||||||| |||||||| || || || |||||||||||| | || ||||| |    
5308068 tctcctacttgcccgtgttgtggaaatgaagatgaaaatgttcttcatgtgcttcgcgattgcatccacgctacccaggtatggctttacatcgttccat 5308167  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| ||  |||| ||||||||||| | |||||||||    
5308168 atgattttataactaatttcttttctttcaattgcagggattggttcttcaataacct 5308225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 237 - 394
Target Start/End: Original strand, 23949124 - 23949281
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    ||||||| |||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||| || || || |||||||||||| | || ||||| |    
23949124 tctcctaattgcccgtgttgtggaaatgaagatgaaactgttcttcatgtgcttcgcgattgcatccacgctacccaggtatggctttacatcgttccat 23949223  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| ||  |||| ||||||||||| | |||||||||    
23949224 atgattttataactaatttcttttctttcaattgcagggattggttcttcaataacct 23949281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 23085684 - 23085527
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||| | |||| ||| ||||| ||||||| ||| |||||||||||||| ||||||||  | || ||||||||||||||| | |||||||| |    
23085684 tctcctacttgcacgtgttatggaaatgaagatgaaattgttcttcatgtgcttcgcgattgcatctacgctactcaggtatggctttacattgttccat 23085585  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| || ||||| | ||||||||| | |||||||||    
23085584 atgattttataactaatttcttttctttcgattgcaaggattggttcttcaataacct 23085527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 237 - 394
Target Start/End: Original strand, 23722713 - 23722870
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    ||||||||||| || |||||||| ||||| ||||||| ||| |||||||||||||| |||||||| || || || || ||||||||| | || ||||| |    
23722713 tctcctacttgtccgtgttgtggaaatgaagatgaaattgttcttcatgtgcttcgcgattgcatccacgctacccaagtatggctttacatcgttccat 23722812  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| || ||||| ||||||||||| | |||||||||    
23722813 atgattttataactaatttcttttctttcgattgcagggattggttcttcaataacct 23722870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 274 - 394
Target Start/End: Complemental strand, 50953304 - 50953184
Alignment:
274 ctgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttccttccgactttataactaacttcttttcctttgattgtag 373  Q
    |||| |||||||||||| ||||||||||| ||||  | || ||||||||| | || ||||| |  || ||||||||||| |||||||| || ||||| ||    
50953304 ctgttcttcatgtgctttgtgattgcatttatgctgcccatgtatggctttacatcgttccatatgattttataactaatttcttttctttcgattgcag 50953205  T
374 ggattggttttccaataacct 394  Q
    ||||||||| | |||||||||    
50953204 ggattggttcttcaataacct 50953184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 606 - 679
Target Start/End: Complemental strand, 23085315 - 23085242
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||| ||||||||||||||||| || || || ||||| ||||||||||||||    
23085315 atctatataggttggaagcggcctcaagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 23085242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Original strand, 5308437 - 5308510
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
5308437 atctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 5308510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Original strand, 23949493 - 23949566
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
23949493 atctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 23949566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 679
Target Start/End: Complemental strand, 50952972 - 50952899
Alignment:
606 atctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
50952972 atctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 50952899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 227 - 699
Target Start/End: Original strand, 18882796 - 18883268
Alignment:
227 tgttgggatttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcat 326  Q
    ||||||||||| ||||||||||||||||||||||||| | ||||||| |||||||||||||||| |||| || |||||||||||||||||||||||||||    
18882796 tgttgggatttttcctacttgcccatgttgtgggaataatgatgaaaatgtccttcatgtgctttgtgactgtattcatgcaactcaggtatggcttcat 18882895  T
327 attgttccttccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatcta 426  Q
    |||||||| || || |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||    
18882896 attgttccctctgattttataactaacttcttttcctttgactgtagggattggtttttcaataaccttaagaggaaaatggttgggacgagcacatcta 18882995  T
427 gatggcagaccacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatat 526  Q
    |||| ||||||||||| ||||||| ||  | ||||||||||||||||| |||||| ||||||||| || | |||||||||||||| ||||||||||||||    
18882996 gatgacagaccaccttcatgactatgtactagtatttgtggaaatggaagaacaaaactatctttaaacctgatttccaaaggccaaataatccaaatat 18883095  T
527 actaatccaaacattcgttagagatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacga 626  Q
    | || || | | |||||||| ||||||||||||||| |||||||||||| |||||| |||||||||||||| ||| ||||||| ||||||||||||||||    
18883096 attagtctagagattcgttaaagatattgaagactaaaacttggagcaccttcatatagggcctaaggtgaaggagactatcttcataggatggaaacga 18883195  T
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtg 699  Q
    |||||||||||||||||||||||||||| ||||||||||| ||||||| | ||||||||||||||||||||||    
18883196 cctcaggaaggttggatcaagctcaacaacgacggtgcctccaaggatctaggtcatatttccggttgtggtg 18883268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 555 - 687
Target Start/End: Complemental strand, 4560769 - 4560637
Alignment:
555 gaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaagctcaaca 654  Q
    |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
4560769 gaagactacaacttggagcactttcataaagggcctaaggtggcggacactatctacataggatggaaacgacctcaggaaggttggatcaagctcgaca 4560670  T
655 gcgacggtgcctgcaaggatatgggtcatattt 687  Q
    |||| ||||||||||||||||||||||||||||    
4560669 gcgatggtgcctgcaaggatatgggtcatattt 4560637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 679
Target Start/End: Complemental strand, 34081200 - 34081069
Alignment:
548 agatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaag 647  Q
    |||||||||||| |  |||||||||||  ||||||  || || ||| ||| ||| |  ||||| ||||| ||||| || ||||  |||||||||||||||    
34081200 agatattgaagattgtaacttggagcatattcatattggtccaaagttgaaggaaatcatctatataggttggaagcggcctcgagaaggttggatcaag 34081101  T
648 ctcaacagcgacggtgcctgcaaggatatggg 679  Q
    || || || || ||||| ||||||||||||||    
34081100 cttaatagtgatggtgcttgcaaggatatggg 34081069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 240 - 322
Target Start/End: Original strand, 14024272 - 14024354
Alignment:
240 cctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggct 322  Q
    |||||||| || ||||||| ||  ||||||||||| ||| ||||||| |||||||||||  | || || ||||||||||||||    
14024272 cctacttgtccttgttgtgcgagagaggatgaaacagtcattcatgtccttcgtgattgtgtgcacgctactcaggtatggct 14024354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 482 - 699
Target Start/End: Complemental strand, 47598118 - 47597901
Alignment:
482 gactatctttgaagcggatttccaaaggccgaataatccaaatatactaatccaaacattcgttagagatattgaagactacaacttggagcactttcat 581  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47598118 gactatctttgaagcggatttccaaaggccgaataatccaaatatactaatccaaacattcgttagagatattgaagactacaacttggagcactttcat 47598019  T
582 agagggcctaaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtc 681  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
47598018 agagggcctaaggtgacagacattatctacataggatggaaacgacctcaagaaggttggatcaaactcaacagcgacggtgcctgcaaggatatgggtc 47597919  T
682 atatttccggttgtggtg 699  Q
    ||||||||||||||||||    
47597918 atatttccggttgtggtg 47597901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 36895189 - 36895032
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||| |||  ||||||||||||| ||||||||  | || ||||||||||||||| | || ||||| |    
36895189 tctcctacttgcccgtgttgtggaaatgaagatgaaattgtttttcatgtgcttcgcgattgcatctacgctactcaggtatggctttacatcgttccat 36895090  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||| ||||||| |||||||| || ||||| ||||||||||| | |||||||||    
36895089 atgattttgtaactaatttcttttctttcgattgcagggattggttcttcaataacct 36895032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 34390578 - 34390421
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||  |||||||| ||||| ||||||||||| |||||||||||||| ||||||||  | || || || ||||||||| | || ||||| |    
34390578 tctcctacttgcctgtgttgtggaaatgaagatgaaactgttcttcatgtgcttcgcgattgcatctacgctacccatgtatggctttacatcgttccat 34390479  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| || ||||| | ||||||||| | |||||||||    
34390478 atgattttataactaatttcttttctttcgattgcaaggattggttcttcaataacct 34390421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 240 - 322
Target Start/End: Original strand, 1368771 - 1368853
Alignment:
240 cctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggct 322  Q
    |||||||| || ||||||| ||  ||||||||||| ||| ||||||| |||||||||||  | || || ||||||||||||||    
1368771 cctacttgtccttgttgtgcgagagaggatgaaacagtcattcatgtccttcgtgattgtgtgcacgctactcaggtatggct 1368853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 605 - 679
Target Start/End: Complemental strand, 34390210 - 34390136
Alignment:
605 tatctacataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    |||||| ||||| ||||| || ||||  ||||||||||||||||| || || || ||||| ||||||||||||||    
34390210 tatctatataggttggaagcggcctcgagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 34390136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 83; Significance: 6e-39; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 6e-39
Query Start/End: Original strand, 237 - 503
Target Start/End: Complemental strand, 40197159 - 40196893
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||| ||| |||| ||||||| |||||||||| |||||||||| |||||||||| | ||  || |||    
40197159 tctcctacttgcccgtgttgtggaaatgaagatgaaattgttcttcgtgtgctttgtgattgcatccatgcaactcgggtatggctttacatcctttctt 40197060  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataaccttaagagaaaaatggttgggacaagcacatctagatggcagac 436  Q
    | || ||||||||||| |||||||| |||||||| ||||||||||| | ||||||||| || |  |||   |||||||| | ||| |  || ||| ||||    
40197059 ctgattttataactaatttcttttcttttgattgcagggattggttcttcaataacctcaacaagaaagacgttgggacgaacactttaagttggaagac 40196960  T
437 cacctttatgactacgtgttggtatttgtggaaatggaggaacaagactatctttgaagcggatttc 503  Q
     || || ||||| | ||||||||| |||||||| |||||||| || ||||| |||||||| ||||||    
40196959 aactttcatgacgatgtgttggtacttgtggaagtggaggaataaaactatttttgaagctgatttc 40196893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 237 - 394
Target Start/End: Complemental strand, 7305854 - 7305697
Alignment:
237 tctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttcctt 336  Q
    |||||||||||||| |||||||| ||||| ||||||||||| ||||| |||||||| ||||||||  | || ||||||||||||||| | || ||||| |    
7305854 tctcctacttgcccgtgttgtggaaatgaagatgaaactgttcttcacgtgcttcgcgattgcatctacgctactcaggtatggctttacatcgttccat 7305755  T
337 ccgactttataactaacttcttttcctttgattgtagggattggttttccaataacct 394  Q
      || ||||||||||| |||||||| || ||||| ||||||||||| | |||||||||    
7305754 atgattttataactaatttcttttctttcgattgcagggattggttcttcaataacct 7305697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 275 - 622
Target Start/End: Complemental strand, 26382006 - 26381659
Alignment:
275 tgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatggcttcatattgttccttccgactttataactaacttcttttcctttgattgtagg 374  Q
    |||| |||| ||| ||| ||| |||||||| ||||| || |||||| |||||||||||||||| || ||||||| ||| || ||||| |||||||| |||    
26382006 tgtcattcacgtgattcatgactgcattcacgcaacccaagtatggtttcatattgttccttctgattttataaataatttattttcttttgattgcagg 26381907  T
375 gattggttttccaataaccttaagagaaaaatggttgggacaagcacatctagatggcagaccacctttatgactacgtgttggtatttgtggaaatgga 474  Q
    |||||  ||| ||||||||| || ||||||  |||||| || ||||  || |  ||||| |||||||| ||| | || || ||| || | ||||| || |    
26381906 gattgaattttcaataacctcaatagaaaaggggttggaacgagcagctccaattggcataccaccttcatggcaacttgctggcatctatggaagtgaa 26381807  T
475 ggaacaagactatctttgaagcggatttccaaaggccgaataatccaaatatactaatccaaacattcgttagagatattgaagactacaacttggagca 574  Q
    | ||||| ||||||||||||||  |||| || ||||| || || |||||| || | ||  |    ||||| | ||||||||| ||||  ||||| || ||    
26381806 gcaacaaaactatctttgaagctaattttcagaggccaaacaacccaaatttaatgattaagcgtttcgtcaaagatattgaggactgtaacttagaaca 26381707  T
575 ctttcatagagggcctaaggtgacggacactatctacataggatggaa 622  Q
      ||||||| || | |||| ||| ||| ||||||||||||||||||||    
26381706 tcttcatagtggtcataagttgaaggaaactatctacataggatggaa 26381659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 234 - 320
Target Start/End: Complemental strand, 42161834 - 42161748
Alignment:
234 atttctcctacttgcccatgttgtgggaatgaggatgaaactgtccttcatgtgcttcgtgattgcattcatgcaactcaggtatgg 320  Q
    ||||| |||||||| || |||||||||||||   |||| || ||  |||||||||||||||||||||  |||||| |||||||||||    
42161834 atttcgcctacttgtccttgttgtgggaatgcaaatgagaccgttattcatgtgcttcgtgattgcaggcatgcatctcaggtatgg 42161748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 627 - 679
Target Start/End: Complemental strand, 7305465 - 7305413
Alignment:
627 cctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatggg 679  Q
    ||||| ||||||||||||||||| || || || ||||| ||||||||||||||    
7305465 cctcaagaaggttggatcaagcttaatagtgatggtgcttgcaaggatatggg 7305413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 548 - 680
Target Start/End: Complemental strand, 40196849 - 40196717
Alignment:
548 agatattgaagactacaacttggagcactttcatagagggcctaaggtgacggacactatctacataggatggaaacgacctcaggaaggttggatcaag 647  Q
    |||||||||||| |  |||||||||||  ||||||  || || ||| |||  ||||  ||||| ||||| ||||| || ||||  |||||||||||||||    
40196849 agatattgaagaatgtaacttggagcatcttcatattggtccaaagttgaaagacatcatctatataggttggaagcggcctcgagaaggttggatcaag 40196750  T
648 ctcaacagcgacggtgcctgcaaggatatgggt 680  Q
    |||||||  |  ||||| |||||| ||||||||    
40196749 ctcaacaatggtggtgcttgcaagaatatgggt 40196717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 612 - 700
Target Start/End: Original strand, 355705 - 355793
Alignment:
612 ataggatggaaacgacctcaggaaggttggatcaagctcaacagcgacggtgcctgcaaggatatgggtcatatttccggttgtggtga 700  Q
    |||||||| || | ||| || ||||||| ||||||||||||||  || ||||| |||||||||| |||||||||||  | |||||||||    
355705 ataggatgaaagcaaccacaagaaggttcgatcaagctcaacaatgatggtgcatgcaaggataggggtcatattttggattgtggtga 355793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142093 times since January 2019
Visitors: 1479