View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565-INSERTION-2 (Length: 843)

Name: NF1565-INSERTION-2
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565-INSERTION-2
NF1565-INSERTION-2
[»] chr1 (5 HSPs)
chr1 (8-173)||(26925678-26925847)
chr1 (649-843)||(49043611-49043804)
chr1 (645-843)||(42071632-42071829)
chr1 (642-738)||(12486644-12486740)
chr1 (712-843)||(42646325-42646455)
[»] chr7 (8 HSPs)
chr7 (8-119)||(35542975-35543087)
chr7 (139-226)||(38129891-38129978)
chr7 (144-198)||(35543090-35543144)
chr7 (669-799)||(4668397-4668528)
chr7 (649-787)||(5678570-5678709)
chr7 (649-787)||(5703622-5703761)
chr7 (179-226)||(9417912-9417959)
chr7 (712-768)||(4668733-4668790)
[»] chr3 (10 HSPs)
chr3 (644-840)||(4580138-4580338)
chr3 (671-840)||(20398717-20398885)
chr3 (676-842)||(25857337-25857501)
chr3 (674-816)||(33620343-33620485)
chr3 (653-780)||(40594099-40594227)
chr3 (669-843)||(39913540-39913713)
chr3 (176-226)||(25704569-25704619)
chr3 (144-205)||(5118986-5119047)
chr3 (193-230)||(5119063-5119100)
chr3 (653-738)||(41218142-41218227)
[»] chr6 (11 HSPs)
chr6 (649-843)||(3565321-3565514)
chr6 (643-783)||(1954061-1954202)
chr6 (649-843)||(13394492-13394685)
chr6 (649-843)||(19231910-19232103)
chr6 (155-224)||(21540429-21540498)
chr6 (654-843)||(2940002-2940191)
chr6 (668-760)||(10779515-10779608)
chr6 (710-787)||(2339417-2339495)
chr6 (715-769)||(1954289-1954344)
chr6 (168-231)||(22880844-22880903)
chr6 (168-231)||(22898779-22898838)
[»] chr2 (2 HSPs)
chr2 (649-800)||(8781098-8781249)
chr2 (672-843)||(18725905-18726078)
[»] chr8 (2 HSPs)
chr8 (649-726)||(4361147-4361224)
chr8 (750-843)||(26150369-26150460)
[»] chr4 (4 HSPs)
chr4 (649-738)||(19684945-19685034)
chr4 (150-199)||(23186934-23186983)
chr4 (645-760)||(2053319-2053437)
chr4 (712-768)||(38223410-38223467)
[»] chr5 (1 HSPs)
chr5 (649-783)||(19677500-19677634)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 1e-49; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 26925847 - 26925678
Alignment:
8 cacatgagaacaattgactgagtttcgagtacttgccatatccatgaggaaaaatgtaacgcagaaggagggaatagtggagggaa----aaaatgtaac 103  Q
    ||||||||||||||||| ||||||| ||| |||||||||||||||||| ||||||||||| || ||||||||||||||||||||||    ||||||||||    
26925847 cacatgagaacaattgattgagttttgagcacttgccatatccatgagaaaaaatgtaacccaaaaggagggaatagtggagggaaaaaaaaaatgtaac 26925748  T
104 aattgaggggggaatatcgtaaattgaggagggaatacatattgagttgtatttagaatgtgactattta 173  Q
    |||||||| ||||||| ||||||||||||||||| ||||  || ||||||||||| ||||||||||||||    
26925747 aattgaggagggaataccgtaaattgaggagggagtacacgttcagttgtatttaaaatgtgactattta 26925678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 649 - 843
Target Start/End: Original strand, 49043611 - 49043804
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgga-tgaccc 747  Q
    |||||||||||| || |  | ||| ||| |||| |||||||| |||||||||| |||  ||  ||||||||| |||||||||| |||||  || ||||||    
49043611 tgatgtagacaaattggcggtgcgtatcaaagatgaagtggcatgcaagaaaggttcattcagaatggtgcaaattttgcatccggtgttagaatgaccc 49043710  T
748 gaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    ||||||||||||| |||||||| || || ||||||||||| ||||||||| ||   ||||| ||| ||| | ||||||||||||||||||||||||    
49043711 gaattataccttttcggaaagcatcggatctcacgagcaaaactcatcgc-ttcatcatgaagta-gggatgaatttagtcatttgaggtcgtctg 49043804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 645 - 843
Target Start/End: Complemental strand, 42071829 - 42071632
Alignment:
645 aaagtgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgt-cggatg 743  Q
    ||||||||||||| ||| ||| ||| | |||||||||||||||||   | ||||||| ||  || |||| |||| |||||||| | | ||||| ||  ||    
42071829 aaagtgatgtagaaaagctagtagcaccaatcgaagacgaagtggtacgtaagaaaggtttagttgaaacggtgtagattttgtacccggtgtccgtttg 42071730  T
744 acccgaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    | ||||||| ||||||| || |||| | | |||||| ||||||| ||||||||| |||||||||| ||| ||||||| |||||||||| |||||||||||    
42071729 atccgaattgtaccttttcgaaaagtcccggacctcgcgagcaaaactcatcgc-tttgccatgatgta-ggggttattttagtcattcgaggtcgtctg 42071632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 642 - 738
Target Start/End: Complemental strand, 12486740 - 12486644
Alignment:
642 aataaagtgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtc 738  Q
    |||||| ||||||||||||| ||| ||| |||||| | || ||||||||| ||||||||| ||  |||| || ||||||||||||||||||||||||    
12486740 aataaattgatgtagacaagctagcagcacgaatcaaggaagaagtggcgcgcaagaaaggtttagtcggaacggtgcagattttgcatctggtgtc 12486644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 712 - 843
Target Start/End: Original strand, 42646325 - 42646455
Alignment:
712 aatggtgcagattttgcatctggtgtcgga-tgacccgaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacg 810  Q
    |||||||||||||||| ||  ||||||||| |||| |||||||||||||| ||||||||  | || ||||||||||| |||| |  | |||| ||||  |    
42646325 aatggtgcagattttgtattcggtgtcggaatgactcgaattataccttttcggaaagcaccagatctcacgagcaaaactcctttc-tttgtcatgttg 42646423  T
811 tagggggttaatttagtcatttgaggtcgtctg 843  Q
    || ||||| |||||||||||| |||||||||||    
42646424 ta-ggggtgaatttagtcattcgaggtcgtctg 42646455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 77; Significance: 3e-35; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 35542975 - 35543087
Alignment:
8 cacatgagaacaattgactgagtttcgagtacttgccatatccatgaggaaaaatgtaacgcagaaggagggaatagtggaggga-aaaaatgtaacaat 106  Q
    |||||||||| |||||| ||||||  ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||    
35542975 cacatgagaaaaattgattgagttctgagcacttgccatatccatgagaaaaaatgtaacgcagaaggagggaatagtggagggagaaaaatgtaacaat 35543074  T
107 tgaggggggaata 119  Q
    ||||| |||||||    
35543075 tgaggagggaata 35543087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 139 - 226
Target Start/End: Original strand, 38129891 - 38129978
Alignment:
139 tacatattgagttgtatttagaatgtgactatttaatttttcacaaaatacaataaatagagtggttaatagtggagagagatggagg 226  Q
    |||| |||||||| |||||||||  ||| |||||||||||||| ||||||||||||||| | |||||||||| |||||||||||||||    
38129891 tacacattgagttttatttagaagatgattatttaatttttcataaaatacaataaatataatggttaataggggagagagatggagg 38129978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 144 - 198
Target Start/End: Original strand, 35543090 - 35543144
Alignment:
144 attgagttgtatttagaatgtgactatttaatttttcacaaaatacaataaatag 198  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
35543090 attgagttgtatttagaatgtgactatttagtttttcacaaaatacaataaatag 35543144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 669 - 799
Target Start/End: Complemental strand, 4668528 - 4668397
Alignment:
669 cgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgga-tgacccgaattatacctttccggaaa 767  Q
    |||| ||||| ||||||||||| |||||||||  |||  ||||| ||||| ||||||||| |  ||||||||| | |||  |||||||||||| ||||||    
4668528 cgcgtatcgatgacgaagtggcttgcaagaaaagttcaatcgaagtggtgtagattttgctttcggtgtcggaattaccataattataccttttcggaaa 4668429  T
768 gcctctgacctcacgagcaatactcatcgctt 799  Q
    | ||| |||||||||||||| |||||||||||    
4668428 gtctcagacctcacgagcaaaactcatcgctt 4668397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 649 - 787
Target Start/End: Complemental strand, 5678709 - 5678570
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcggat-gaccc 747  Q
    |||||| |||||| |||||||   ||| ||||||||||||||  | ||||||| ||  |||| || || |||||||||||||   ||||| ||| |||||    
5678709 tgatgtggacaagctagaagcataaattgaagacgaagtggcacgtaagaaagatttagtcggaacggggcagattttgcattccgtgtccgattgaccc 5678610  T
748 gaattatacctttccggaaagcctctgacctcacgagcaa 787  Q
    ||||||||||||| | ||||||| || |||||||||||||    
5678609 gaattataccttttcagaaagcccctaacctcacgagcaa 5678570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 649 - 787
Target Start/End: Complemental strand, 5703761 - 5703622
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcggat-gaccc 747  Q
    |||||| |||||| |||||||   ||| ||||||||||||||  | ||||||| ||  |||| || || |||||||||||||   ||||| ||| |||||    
5703761 tgatgtggacaagctagaagcataaattgaagacgaagtggcacgtaagaaagatttagtcggaacggggcagattttgcattccgtgtccgattgaccc 5703662  T
748 gaattatacctttccggaaagcctctgacctcacgagcaa 787  Q
    ||||||||||||| | ||||||| || |||||||||||||    
5703661 gaattataccttttcagaaagcccctaacctcacgagcaa 5703622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 179 - 226
Target Start/End: Original strand, 9417912 - 9417959
Alignment:
179 tcacaaaatacaataaatagagtggttaatagtggagagagatggagg 226  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||    
9417912 tcacaaaatacaataaatagattggttaataggggagagagatggagg 9417959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 712 - 768
Target Start/End: Complemental strand, 4668790 - 4668733
Alignment:
712 aatggtgcagattttgcatctggtgtcgga-tgacccgaattatacctttccggaaag 768  Q
    ||||||||||| ||||| |||| ||||||| |||||| |||||||||||| |||||||    
4668790 aatggtgcagaatttgcttctgatgtcggaatgacccaaattataccttttcggaaag 4668733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 4e-28; HSPs: 10)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 644 - 840
Target Start/End: Original strand, 4580138 - 4580338
Alignment:
644 taaagtgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgga-t 742  Q
    |||| ||||||||||||| | | |||||||||||||||| |||||| |  |||||||| |||  ||| |||| |||| ||||||||||  |||||||| |    
4580138 taaaatgatgtagacaagctggtagcgcgaatcgaagacaaagtggggcccaagaaaggttcactcggaatgatgcatattttgcatccagtgtcggaat 4580237  T
743 gacccgaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatg----acgtagggggttaatttagtcatttgaggtc 838  Q
    |||||||||||||||||| ||||||||| | ||||||| |||||| ||||||| | |||| ||||    | |||||||||||| ||||||||| ||||||    
4580238 gacccgaattataccttttcggaaagccccggacctcaagagcaaaactcatcac-tttgtcatgatgtatgtagggggttaaattagtcattcgaggtc 4580336  T
839 gt 840  Q
    ||    
4580337 gt 4580338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 671 - 840
Target Start/End: Complemental strand, 20398885 - 20398717
Alignment:
671 cgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgga-tgacccgaattatacctttccggaaagc 769  Q
    ||||||||||||||||||||| ||||||||| ||| |||  ||| ||||||||||| |||| |||||| || ||| | |||||||| |||| |||||| |    
20398885 cgaatcgaagacgaagtggcgcgcaagaaaggttcagtcagaattgtgcagattttacatccggtgtcagattgatcagaattatatcttttcggaaaac 20398786  T
770 ctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgt 840  Q
    ||  |||||||||||||  ||||||||| |||||||||| |||  | |||| |||||||||| ||||||||    
20398785 cttggacctcacgagcagaactcatcgc-tttgccatgaagta-tgagttattttagtcattcgaggtcgt 20398717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 676 - 842
Target Start/End: Original strand, 25857337 - 25857501
Alignment:
676 cgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgt-cggatgacccgaattatacctttccggaaagcctctg 774  Q
    |||| |||||| || | ||||||||| ||| |||| || |||||| ||||||||||  || | ||  ||| | ||||||||||||| ||||||| ||| |    
25857337 cgaaaacgaagcggtgcgcaagaaaggttcagtcggaacggtgcaaattttgcatccagtattcgtttgatctgaattataccttttcggaaag-ctcgg 25857435  T
775 acctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtct 842  Q
    ||||||||||||| || |||||| || ||||||||||| ||||||| |||||||||| ||||||||||    
25857436 acctcacgagcaaaacacatcgc-ttcgccatgacgta-ggggttattttagtcattcgaggtcgtct 25857501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 674 - 816
Target Start/End: Complemental strand, 33620485 - 33620343
Alignment:
674 atcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgg-atgacccgaattatacctttccggaaagcctc 772  Q
    ||||||||||||||| || ||||||||| |||  ||| ||||||| | ||||| |||| |||||||| ||||||||||||||| |||| ||||||||  |    
33620485 atcgaagacgaagtgacgcgcaagaaaggttcactcggaatggtgtatattttacatccggtgtcggaatgacccgaattatatcttttcggaaagctcc 33620386  T
773 tgacctcacgagcaatactcatcgcttttgccatgacgtagggg 816  Q
     |||||||| ||||| | |||| ||| || |||||| |||||||    
33620385 ggacctcacaagcaaaattcatggctctt-ccatgatgtagggg 33620343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 653 - 780
Target Start/End: Complemental strand, 40594227 - 40594099
Alignment:
653 gtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcggat-gacccgaat 751  Q
    ||||||||| |  |||| |||||||| || |||| |||   |||||||| ||| |||| || ||||||||||||||||| |||||| | | |||||||||    
40594227 gtagacaagctgaaagcacgaatcgaggaagaagcggcacacaagaaaggttcagtcggaacggtgcagattttgcatccggtgtccgtttgacccgaat 40594128  T
752 tatacctttccggaaagcctctgacctca 780  Q
    |||||| || ||||||||||| |||||||    
40594127 tataccatttcggaaagcctcagacctca 40594099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 669 - 843
Target Start/End: Complemental strand, 39913713 - 39913540
Alignment:
669 cgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcggat-gacccgaattatacctttccggaaa 767  Q
    |||||||| |||||||||||||| ||| ||||| ||  |||  || | |||| ||||| |||| | |||| | | ||||| |||||||||||| ||||||    
39913713 cgcgaatcaaagacgaagtggcgcgcatgaaaggtttagtcagaacgatgcaaatttttcatccgatgtccgtttgacccaaattataccttttcggaaa 39913614  T
768 gcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    || || |||||||||||||| || |||| | |||||||||| | |  || ||| |||||||||| |||||||||||    
39913613 gcgtcagacctcacgagcaaaacacatcac-tttgccatgatg-aatggtttattttagtcattcgaggtcgtctg 39913540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 25704619 - 25704569
Alignment:
176 ttttcacaaaatacaataaatagagtggttaatagtggagagagatggagg 226  Q
    ||||||||||||| |||||||||||| |||||||| || ||||||||||||    
25704619 ttttcacaaaatataataaatagagtagttaatagaggtgagagatggagg 25704569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 205
Target Start/End: Original strand, 5118986 - 5119047
Alignment:
144 attgagttgtatttagaatgtgactatttaatttttcacaaaatacaataaatagagtggtt 205  Q
    ||||| ||||||||||||  ||| |||||| |||||||||||| ||||| ||||||||||||    
5118986 attgaattgtatttagaagatgattatttagtttttcacaaaaaacaatcaatagagtggtt 5119047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 5119063 - 5119100
Alignment:
193 aaatagagtggttaatagtggagagagatggaggaaaa 230  Q
    |||||||||||||||||| |||||||||||||||||||    
5119063 aaatagagtggttaataggggagagagatggaggaaaa 5119100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 653 - 738
Target Start/End: Original strand, 41218142 - 41218227
Alignment:
653 gtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtc 738  Q
    ||||||||| ||||||| || ||||| || |||||||||  |||||||  ||| ||| ||| |||| ||||||||||||| |||||    
41218142 gtagacaagctagaagcacggatcgaggatgaagtggcgcacaagaaatgttcagtcaaaagggtgtagattttgcatctcgtgtc 41218227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 4e-25; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 649 - 843
Target Start/End: Original strand, 3565321 - 3565514
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgg-atgaccc 747  Q
    ||||||||||||||| | ||||||||||||||||||||||||| | ||||||| ||  |||| | |||||| ||||| ||||| |  ||||| || ||      
3565321 tgatgtagacaagttggcagcgcgaatcgaagacgaagtggcgcgtaagaaaggtttagtcggattggtgctgatttagcatccgacgtcggaataacat 3565420  T
748 gaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    |||||| ||||||  | |||||| | |||||||||||||||||||||||| |||| ||||| ||| || ||||||||| ||||| |||||||||||    
3565421 gaattaaacctttttgaaaagccccggacctcacgagcaatactcatcgc-tttgtcatgatgta-ggagttaatttaatcattcgaggtcgtctg 3565514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 643 - 783
Target Start/End: Original strand, 1954061 - 1954202
Alignment:
643 ataaagtgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgg-a 741  Q
    ||||| ||||||||||||| ||| ||| |||||||| || ||||||||| ||||||||| ||   ||| || ||||| ||||||||||| | ||||||      
1954061 ataaactgatgtagacaagctagcagcacgaatcgaggaagaagtggcgcgcaagaaaggttgaatcggaacggtgctgattttgcatccgatgtcggtt 1954160  T
742 tgacccgaattatacctttccggaaagcctctgacctcacga 783  Q
    ||||||||||||||||||| ||||||||| ||||| ||||||    
1954161 tgacccgaattataccttttcggaaagcccctgacgtcacga 1954202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 649 - 843
Target Start/End: Complemental strand, 13394685 - 13394492
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgga-tgaccc 747  Q
    |||| |||||||| ||| ||| |||||||||||||| |||||  ||||||||| ||| ||| |||||||||| ||||| |||  |||||| || ||| ||    
13394685 tgatatagacaagctagcagcacgaatcgaagacgatgtggcacgcaagaaaggttcagtcaaaatggtgcatatttttcattcggtgtctgattgatcc 13394586  T
748 gaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
     |||||||||||| |||||||||   ||| |||||| | | || ||| || || ||||||||||| ||||||| |||||||||| |||||| ||||    
13394585 aaattataccttttcggaaagcccaagacttcacgatctaaacacattgc-ttcgccatgacgta-ggggttagtttagtcattcgaggtcatctg 13394492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 649 - 843
Target Start/End: Original strand, 19231910 - 19232103
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtc-ggatgaccc 747  Q
    ||||||||| ||| ||| ||  ||||||||||| ||||||| ||| ||||||| ||| |||| || |||||| |||||||||| |||||| |  ||  |     
19231910 tgatgtagataagctagtagtacgaatcgaagatgaagtggtgtgtaagaaaggttcagtcggaacggtgcatattttgcatccggtgtctgtttggtct 19232009  T
748 gaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    |||||||||||||  |||||||| | ||||||||||| || ||||||| | |||||||||||  |  |||||| |||||||||| |||||||||||    
19232010 gaattatacctttttggaaagccccagacctcacgagaaaaactcatcac-tttgccatgacaca-tgggttattttagtcattcgaggtcgtctg 19232103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 155 - 224
Target Start/End: Original strand, 21540429 - 21540498
Alignment:
155 tttagaatgtgactatttaatttttcacaaaatacaataaatagagtggttaatagtggagagagatgga 224  Q
    |||||||| |||||||||| |||||||||||||||||| |||||||||||||||| |  |||||||||||    
21540429 tttagaatatgactatttagtttttcacaaaatacaatgaatagagtggttaatacttcagagagatgga 21540498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 654 - 843
Target Start/End: Complemental strand, 2940191 - 2940002
Alignment:
654 tagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcggat-gaccc-gaat 751  Q
    |||||||| ||| |||  ||||| |||||||||||||| ||||||||| |||    | || |||| | |||||||||| |||||| | | ||||| ||||    
2940191 tagacaagatagcagcatgaatcaaagacgaagtggcgcgcaagaaaggttcaactggaacggtggaaattttgcatccggtgtccgcttgaccccgaat 2940092  T
752 tatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    |||||||||  |||||||| |  |||||||||||||  |||||||| |||||||||| ||| ||||||| |||||||| | |||||||||||    
2940091 tatacctttttggaaagccccgaacctcacgagcaaagctcatcgc-tttgccatgatgta-ggggttattttagtcagtcgaggtcgtctg 2940002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 668 - 760
Target Start/End: Original strand, 10779515 - 10779608
Alignment:
668 gcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtc-ggatgacccgaattataccttt 760  Q
    ||||| || ||||| ||||||||| ||||||||| |||  |  |||||||||||||||||||||||||||| | |||||| ||||||| |||||    
10779515 gcgcgtattgaagatgaagtggcgcgcaagaaaggttcacttaaaatggtgcagattttgcatctggtgtcagaatgacctgaattattccttt 10779608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 710 - 787
Target Start/End: Complemental strand, 2339495 - 2339417
Alignment:
710 gaaatggtgcagattttgcatctggtgtcgga-tgacccgaattatacctttccggaaagcctctgacctcacgagcaa 787  Q
    ||||||||| |||||||| ||| | |||| || ||||||||||||||||||| |||||||||||  | |||||||||||    
2339495 gaaatggtgtagattttgtatccgatgtcagaatgacccgaattataccttttcggaaagcctcatatctcacgagcaa 2339417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 715 - 769
Target Start/End: Complemental strand, 1954344 - 1954289
Alignment:
715 ggtgcagattttgcatctggtgtcggat-gacccgaattatacctttccggaaagc 769  Q
    |||||| |||||| |||||||||||| | |||||||||||||||||| ||||||||    
1954344 ggtgcatattttgtatctggtgtcggtttgacccgaattataccttttcggaaagc 1954289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 231
Target Start/End: Complemental strand, 22880903 - 22880844
Alignment:
168 tatttaatttttcacaaaatacaataaatagagtggttaatagtggagagagatggaggaaaat 231  Q
    |||||| ||||||| |||||||||||||||||||||    ||| ||||||||||||||| ||||    
22880903 tatttagtttttcaaaaaatacaataaatagagtgg----tagaggagagagatggagggaaat 22880844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 231
Target Start/End: Complemental strand, 22898838 - 22898779
Alignment:
168 tatttaatttttcacaaaatacaataaatagagtggttaatagtggagagagatggaggaaaat 231  Q
    |||||| ||||||| |||||||||||||||||||||    ||| ||||||||||||||| ||||    
22898838 tatttagtttttcaaaaaatacaataaatagagtgg----tagaggagagagatggagggaaat 22898779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 6e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 649 - 800
Target Start/End: Original strand, 8781098 - 8781249
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgt-cggatgaccc 747  Q
    ||||||||||||| ||| ||| | |||| |||||||||||||| ||||||||| ||| |||  || ||||||||||||||||||||||| ||  |||||     
8781098 tgatgtagacaagctagcagcacaaatcaaagacgaagtggcgcgcaagaaaggttcagtcagaacggtgcagattttgcatctggtgtccgtttgacct 8781197  T
748 gaattatacctttccggaaagcctctgacctcacgagcaatactcatcgcttt 800  Q
    ||| |||||||||  | |||||| | |||||||||||||| |||||| |||||    
8781198 gaa-tatacctttttgaaaagccccggacctcacgagcaaaactcatagcttt 8781249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 672 - 843
Target Start/End: Complemental strand, 18726078 - 18725905
Alignment:
672 gaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtcgg----atgacccgaattatacctttccggaaa 767  Q
    |||||||||||||||||  | ||||||||| ||| |||| | ||||| |||||||||||| |||||||     |||| | || |||||||||| ||||||    
18726078 gaatcgaagacgaagtgatgggcaagaaaggttcagtcggattggtggagattttgcatccggtgtcgatggaatgatctgagttataccttttcggaaa 18725979  T
768 gcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    ||| | ||| |||||||||||||||||||| |||||||||| | | | |||||||||||| ||| ||| |||||||    
18725978 gccccggacttcacgagcaatactcatcgc-tttgccatgatgca-gaggttaatttagtaattcgagatcgtctg 18725905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 649 - 726
Target Start/End: Complemental strand, 4361224 - 4361147
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagatttt 726  Q
    ||||||||| ||| | | ||| ||||||||||||||||||||| ||||||||| ||| |||| ||| |||||||||||    
4361224 tgatgtagataagctggcagcacgaatcgaagacgaagtggcgcgcaagaaagattcagtcggaatagtgcagatttt 4361147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 750 - 843
Target Start/End: Original strand, 26150369 - 26150460
Alignment:
750 attatacctttccggaaagcctctgacctcacgagcaatactcatcgcttttgccatgacgtagggggttaatttagtcatttgaggtcgtctg 843  Q
    ||||||| ||| ||||||||  | || ||||||||||| | |||||||||| ||||||| ||| ||| ||| |||||||||| |||||||||||    
26150369 attatactttttcggaaagctccggatctcacgagcaaaaatcatcgcttt-gccatgatgtatggg-ttattttagtcattcgaggtcgtctg 26150460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000005; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 649 - 738
Target Start/End: Complemental strand, 19685034 - 19684945
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgtc 738  Q
    |||||||||||||   | ||||| |||||||||||||||||||  |||||||| ||| |||| || |||||| |||||||||| ||||||    
19685034 tgatgtagacaagccggtagcgctaatcgaagacgaagtggcgcacaagaaaggttcagtcggaacggtgcaaattttgcatccggtgtc 19684945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 199
Target Start/End: Complemental strand, 23186983 - 23186934
Alignment:
150 ttgtatttagaatgtgactatttaatttttcacaaaatacaataaataga 199  Q
    ||||||||||||  |||||||||| |||||||||||||||| ||||||||    
23186983 ttgtatttagaagatgactatttagtttttcacaaaatacagtaaataga 23186934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 645 - 760
Target Start/End: Complemental strand, 2053437 - 2053319
Alignment:
645 aaagtgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcg--aaatggtgcagattttgcatctggtgtcgga- 741  Q
    ||||||| ||||||||| | | | | ||||| |||||||  |||| |  |||||||| ||||||||  |||| ||||| ||||||||| ||||||| ||     
2053437 aaagtgacgtagacaagatggcaacacgaattgaagacggcgtggtgcacaagaaaggttcggtcggaaaatagtgcaaattttgcatttggtgtccgac 2053338  T
742 tgacccgaattataccttt 760  Q
    |||||||||||||||||||    
2053337 tgacccgaattataccttt 2053319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 712 - 768
Target Start/End: Complemental strand, 38223467 - 38223410
Alignment:
712 aatggtgcagattttgcatctggtgtc-ggatgacccgaattatacctttccggaaag 768  Q
    ||||||| |||||||||||| |||||| | |||||||||| ||||||||| |||||||    
38223467 aatggtgtagattttgcatccggtgtcagaatgacccgaactataccttttcggaaag 38223410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 649 - 783
Target Start/End: Complemental strand, 19677634 - 19677500
Alignment:
649 tgatgtagacaagttagaagcgcgaatcgaagacgaagtggcgtgcaagaaagtttcggtcgaaatggtgcagattttgcatctggtgt-cggatgaccc 747  Q
    |||||| |||||| ||| || ||||||||||||  |||||||| ||||||||||||| |||  || ||||||||  ||||| | ||||| ||  |||||     
19677634 tgatgttgacaagctagcagtgcgaatcgaagataaagtggcgcgcaagaaagtttcagtcagaacggtgcaga-cttgcacccggtgtccgtttgacct 19677536  T
748 gaattatacctttccggaaagcctctgacctcacga 783  Q
    |||||||||||||  | |||||| | ||||||||||    
19677535 gaattatacctttttgaaaagccccagacctcacga 19677500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142345 times since January 2019
Visitors: 1480