View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565-INSERTION-3 (Length: 90)

Name: NF1565-INSERTION-3
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565-INSERTION-3
NF1565-INSERTION-3
[»] chr3 (4 HSPs)
chr3 (8-82)||(8435286-8435363)
chr3 (8-82)||(27149814-27149891)
chr3 (8-69)||(5165224-5165288)
chr3 (8-82)||(3804653-3804730)
[»] chr6 (1 HSPs)
chr6 (8-68)||(31742706-31742769)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 8e-24; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 8435286 - 8435363
Alignment:
8 tttgtgaggcttgaattggtactcatacat---ctttaatgatagaattacattaattgtaggcaactgtaatgtaag 82  Q
    |||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||| ||||||||||||    
8435286 tttgtgaggcttgaattggtactcatacaatagctttaatgatagaattacattaattgtaggcagctgtaatgtaag 8435363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 27149814 - 27149891
Alignment:
8 tttgtgaggcttgaattggtactcatacat---ctttaatgatagaattacattaattgtaggcaactgtaatgtaag 82  Q
    |||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||| ||||||||||||    
27149814 tttgtgaggcttgaattggtactcatacaatagctttaatgatagaattacattaattgtaggcagctgtaatgtaag 27149891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 5165224 - 5165288
Alignment:
8 tttgtgaggcttgaattggtactcatacat---ctttaatgatagaattacattaattgtaggca 69  Q
    |||||||||||||||||| ||||||||||    ||||||||||||||||||||||||||||||||    
5165224 tttgtgaggcttgaattgatactcatacaatagctttaatgatagaattacattaattgtaggca 5165288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 3804730 - 3804653
Alignment:
8 tttgtgaggcttgaattggtactcatacat---ctttaatgatagaattacattaattgtaggcaactgtaatgtaag 82  Q
    ||||||||||||| ||||| |||||| ||    |||||||||||||||||||||||||||||||| ||| ||||||||    
3804730 tttgtgaggcttggattggaactcatgcaatagctttaatgatagaattacattaattgtaggcagctggaatgtaag 3804653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 7e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 31742706 - 31742769
Alignment:
8 tttgtgaggcttgaattggtactcatacat---ctttaatgatagaattacattaattgtaggc 68  Q
    |||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||    
31742706 tttgtgaggcttgaattggtactcatacaatagctttaatgatagaattacattaattgtaggc 31742769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141817 times since January 2019
Visitors: 1478