View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565-INSERTION-4 (Length: 293)

Name: NF1565-INSERTION-4
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565-INSERTION-4
NF1565-INSERTION-4
[»] chr5 (3 HSPs)
chr5 (8-293)||(16542504-16542789)
chr5 (51-292)||(16533726-16533967)
chr5 (8-59)||(16532841-16532892)


Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 8 - 293
Target Start/End: Original strand, 16542504 - 16542789
Alignment:
8 taaacaatgagtacaagggggtactcaaacccttacaaaataaatctttatatgctttttaaacatacaagaggattacaataccaattagaaaacacaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16542504 taaacaatgagtacaagggggtactcaaacccttacaaaataaatctttatatgctttttaaacatacaagaggattacaataccaattagaaaacacaa 16542603  T
108 agctagatatctctaatgaagaagcatgaccaatttccaatttctccaagaaatccacaattggctgtctttgactattatcatcttcttcctcttcaat 207  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||    
16542604 agctagatatctcttatgaagaagcatgaccaatttccaatttctccaacaaacccagaattggctgtctttgactattatcatcttcttcctcttcaat 16542703  T
208 ttattggtcttgtggtaacataaacccatagatcgatctccaatatgtcacaactttcatctttagtcgcaaccatttgtctagca 293  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||    
16542704 ttattggtcttgtggtaacataaacccatagatccatctccaatatgtcacaactttcatctttattcgcaaccatttgtctagca 16542789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 51 - 292
Target Start/End: Original strand, 16533726 - 16533967
Alignment:
51 atctttatatgctttttaaacatacaagaggattacaataccaattagaaaacacaaagctagatatctctaatgaagaagcatgaccaatttccaattt 150  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
16533726 atctttatatgctttttaaacatacaagaggattacaatattaattagaaaacacaaagctagatatctcttatgaagaagcatgaccaatttccaattt 16533825  T
151 ctccaagaaatccacaattggctgtctttgactattatcatcttcttcctcttcaatttattggtcttgtggtaacataaacccatagatcgatctccaa 250  Q
    |||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
16533826 ctccaacaaacccagaattggctgtctttgactattatcatcttcttcctcttcaatttattggtcttgtggtaacataaacccatagatccatctccaa 16533925  T
251 tatgtcacaactttcatctttagtcgcaaccatttgtctagc 292  Q
    |||||||||||||||||||||| |||||||||||||||||||    
16533926 tatgtcacaactttcatctttattcgcaaccatttgtctagc 16533967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 8 - 59
Target Start/End: Original strand, 16532841 - 16532892
Alignment:
8 taaacaatgagtacaagggggtactcaaacccttacaaaataaatctttata 59  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
16532841 taaacaatgagtacaagggggtactcaaacccttacaaaataaatctttata 16532892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142153 times since January 2019
Visitors: 1479