View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565-INSERTION-5 (Length: 842)

Name: NF1565-INSERTION-5
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565-INSERTION-5
NF1565-INSERTION-5
[»] chr3 (7 HSPs)
chr3 (7-540)||(20991520-20992052)
chr3 (538-838)||(20992092-20992395)
chr3 (193-313)||(20979551-20979671)
chr3 (45-144)||(35310393-35310492)
chr3 (75-150)||(40355898-40355973)
chr3 (45-133)||(18360113-18360199)
chr3 (45-137)||(33486890-33486981)
[»] chr1 (17 HSPs)
chr1 (45-185)||(21322491-21322631)
chr1 (62-189)||(50899052-50899179)
chr1 (62-189)||(29855950-29856078)
chr1 (49-148)||(622901-623000)
chr1 (38-191)||(10369462-10369615)
chr1 (47-154)||(14210612-14210717)
chr1 (62-189)||(32815754-32815881)
chr1 (120-189)||(52186861-52186930)
chr1 (62-135)||(3851727-3851798)
chr1 (47-189)||(27541176-27541317)
chr1 (62-116)||(52186903-52186957)
chr1 (104-153)||(48729056-48729105)
chr1 (61-139)||(25571977-25572055)
chr1 (45-123)||(32827730-32827808)
chr1 (112-189)||(30871942-30872019)
chr1 (93-135)||(3393030-3393072)
chr1 (71-136)||(31847698-31847763)
[»] chr4 (21 HSPs)
chr4 (62-189)||(42747102-42747228)
chr4 (47-189)||(33648207-33648349)
chr4 (76-189)||(35946947-35947058)
chr4 (62-184)||(1845846-1845968)
chr4 (45-181)||(684154-684290)
chr4 (62-174)||(53979037-53979149)
chr4 (68-162)||(16962847-16962941)
chr4 (62-148)||(37182223-37182309)
chr4 (62-131)||(52450149-52450218)
chr4 (45-153)||(50136475-50136582)
chr4 (74-132)||(45800248-45800306)
chr4 (45-137)||(959088-959179)
chr4 (62-148)||(21326264-21326349)
chr4 (46-116)||(29405126-29405196)
chr4 (64-137)||(6083690-6083762)
chr4 (62-135)||(36138956-36139029)
chr4 (62-135)||(56210954-56211026)
chr4 (38-94)||(21027915-21027971)
chr4 (45-100)||(24393615-24393670)
chr4 (148-189)||(21027851-21027892)
chr4 (79-148)||(30211943-30212012)
[»] chr8 (12 HSPs)
chr8 (62-189)||(34072852-34072977)
chr8 (62-148)||(43846273-43846359)
chr8 (45-153)||(38006505-38006619)
chr8 (45-154)||(12750161-12750270)
chr8 (62-108)||(33102104-33102150)
chr8 (62-189)||(35690507-35690634)
chr8 (110-189)||(8983761-8983839)
chr8 (45-116)||(33581843-33581914)
chr8 (47-106)||(22842156-22842215)
chr8 (62-101)||(3434792-3434831)
chr8 (62-116)||(7913312-7913366)
chr8 (49-134)||(5995106-5995191)
[»] chr5 (11 HSPs)
chr5 (94-189)||(28228862-28228957)
chr5 (90-189)||(28217976-28218075)
chr5 (45-136)||(32303614-32303705)
chr5 (45-154)||(37442561-37442669)
chr5 (45-154)||(9828186-9828293)
chr5 (47-148)||(9979634-9979735)
chr5 (62-154)||(42923914-42924006)
chr5 (62-157)||(36781019-36781114)
chr5 (159-192)||(9828179-9828212)
chr5 (90-139)||(28228826-28228875)
chr5 (57-154)||(32827028-32827124)
[»] chr7 (8 HSPs)
chr7 (46-189)||(31756774-31756919)
chr7 (45-150)||(3756381-3756486)
chr7 (105-189)||(16862775-16862859)
chr7 (123-192)||(30755727-30755796)
chr7 (44-95)||(9902174-9902225)
chr7 (44-176)||(48967665-48967801)
chr7 (62-136)||(33818925-33818999)
chr7 (45-155)||(41909312-41909421)
[»] chr6 (13 HSPs)
chr6 (45-189)||(3644739-3644883)
chr6 (46-154)||(28992419-28992527)
chr6 (45-113)||(2725838-2725906)
chr6 (49-101)||(23252896-23252948)
chr6 (45-144)||(2146736-2146834)
chr6 (45-148)||(3607010-3607112)
chr6 (120-189)||(2725793-2725862)
chr6 (62-135)||(2744134-2744207)
chr6 (72-148)||(3788927-3789003)
chr6 (61-108)||(35187909-35187956)
chr6 (62-152)||(1791949-1792039)
chr6 (92-148)||(5076519-5076576)
chr6 (62-111)||(33699322-33699371)
[»] chr2 (8 HSPs)
chr2 (62-194)||(6620026-6620156)
chr2 (45-150)||(44540666-44540771)
chr2 (45-154)||(32016431-32016541)
chr2 (45-136)||(33833422-33833512)
chr2 (68-137)||(13387346-13387415)
chr2 (84-168)||(37426851-37426933)
chr2 (89-137)||(44069891-44069939)
chr2 (61-148)||(39555977-39556063)
[»] scaffold0325 (1 HSPs)
scaffold0325 (44-116)||(14658-14730)
[»] scaffold0254 (1 HSPs)
scaffold0254 (45-144)||(23197-23295)
[»] scaffold0004 (1 HSPs)
scaffold0004 (62-137)||(130711-130786)


Alignment Details
Target: chr3 (Bit Score: 474; Significance: 0; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 474; E-Value: 0
Query Start/End: Original strand, 7 - 540
Target Start/End: Original strand, 20991520 - 20992052
Alignment:
7 agtacgttcaaatggtagtattggaataagaggaaatggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||     
20991520 agtacgttcaaatggtagtattggaataagaggaaatggctcttctcccatctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccaca 20991619  T
107 caggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaattatccagattaagcatgc 206  Q
    |||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
20991620 caggtgtattgtcagcgtgagttaactcacgcagatgtatctctcagcagggatgagcaaaaccagatgggagaagagcaattctccagattaagcatgc 20991719  T
207 ttagttcagtggtgaagtcacactaaatgaatacaaatcatgaccaaagcaatgcaatacattataatacaatacaagaataaaaattcgagattaaagt 306  Q
     |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
20991720 atagttcagtggtgaagtcacactaaatgaatacagatcaagaccaaagcaatgcaatacattataatacaatacaagaataaaaattagagattaaagt 20991819  T
307 agttgtccttcatacttgaatacatatttgctccttgatgactaagaacacaattcagtttagggcaatggaaatgtcaaaagataaatacaaattatct 406  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
20991820 agttgtccttcatacttgaatacatatttgctccctgatgactaagaacacaattcagtttagggcaatggaaatgtc-aaagataaatacaaattatct 20991918  T
407 agttttgtgatctcatacttgttgtgttattcgatacaaattttagtacatgtacatgatgcttttaggaaattaatttctacactaacgatgtaaaact 506  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
20991919 agttttgtgatctcatacttgttgtgttattcgatacaaattttagtacatgtacatgatgcttttaggaaattaatttctacactaacggtgtaaaact 20992018  T
507 attttacatgactattcaatcaaatcatgtcaaa 540  Q
    ||||||||||||||||||||||||||||||||||    
20992019 attttacatgactattcaatcaaatcatgtcaaa 20992052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 272; E-Value: 1e-151
Query Start/End: Original strand, 538 - 838
Target Start/End: Original strand, 20992092 - 20992395
Alignment:
538 aaaatgtttgatcggatgtatatataaaaatgttttac-aatattagcgtgaacaaatacaattcttgttttttgagggtcaaaacgtactggagtttga 636  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20992092 aaaatgtttgatcggatgtatatataaaaatgttttaccaatattagcgtgaacaaatacaattcttgttttttgagggtcaaaacgtactggagtttga 20992191  T
637 tacaagtctatatctatgagactatgactaatcaaaatgttctcaccagttatcaaaagccaagaatatcatcaaaagtgaaactagcacaccacagaac 736  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
20992192 tacaagtctatatctatgagactatgactaatcaaaatgttctcaccagttatcaaaagccaagaatatcatcaaaagtgaaactagcacaccatagaac 20992291  T
737 tacaaaactgttcttc-aaatagcccgcaaaacaaatattccaattagcatccatcctttacaatactatcaatcaccaaggttttatc-atacaattca 834  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
20992292 tacaaaactgttcttcaaaatagcccgcaaaacaaatattcaaattagcatccatcctttacaatactatcaatcaccaaggttttatcaatacaattca 20992391  T
835 tgca 838  Q
    ||||    
20992392 tgca 20992395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 193 - 313
Target Start/End: Original strand, 20979551 - 20979671
Alignment:
193 cagattaagcatgcttagttcagtggtgaagtcacactaaatgaatacaaatcatgaccaaagcaatgcaatacattataatacaatacaagaataaaaa 292  Q
    |||||||||||| | |||||||| |||||| ||||| | |||||||||||||||  | ||||| ||||||||||||||||||||||||||||||||||||    
20979551 cagattaagcatacatagttcagcggtgaaatcacattcaatgaatacaaatcaacatcaaagtaatgcaatacattataatacaatacaagaataaaaa 20979650  T
293 ttcgagattaaagtagttgtc 313  Q
    |||||||||||||||||||||    
20979651 ttcgagattaaagtagttgtc 20979671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 45 - 144
Target Start/End: Complemental strand, 35310492 - 35310393
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    |||| |||||| |||| |||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||| ||||    
35310492 gctcatctcccatctatttttgctcatccccgtcaaaatagccgagcgtgagttaactcacacaggtgtattctcagtgtgagttaactcacgcatgtgt 35310393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 75 - 150
Target Start/End: Original strand, 40355898 - 40355973
Alignment:
75 cgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttct 150  Q
    ||||||||||||||||||||||||||| || | || |||||| ||||||||||||||| ||||||| |||||||||    
40355898 cgtcaaaatagccgagcgtgagttaactcatgtagatgtattttcagcgtgagttaacccacgcagatgtatttct 40355973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 133
Target Start/End: Complemental strand, 18360199 - 18360113
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaact 133  Q
    ||||||||||  |||  ||||| ||||||||||||||| |||  || |||||||||| |||||||||||||| ||||||||||||||||    
18360199 gctcttctcctatctggttttgatcattcccgtcaaaacagc--agtgtgagttaactcacgcaggtgtattttcagcgtgagttaact 18360113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 137
Target Start/End: Complemental strand, 33486981 - 33486890
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    ||||||||| | |||| |||||||||||| |||| ||||||||||  ||||||||||  | ||| ||||||| ||||||||| ||||||||||    
33486981 gctcttctctcgtctatttttgctcattctcgtc-aaatagccgaatgtgagttaacttatgcaagtgtattttcagcgtgaattaactcacg 33486890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 89; Significance: 2e-42; HSPs: 17)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 45 - 185
Target Start/End: Complemental strand, 21322631 - 21322491
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||  ||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||| ||| ||||||||||||||| |||    
21322631 gctcttctcccatctgtttttgctcaatcccgtcaaaatagccgagggtgagttaactcacgcaggtgtattctcaacgtaagttaactcacgcagatgt 21322532  T
145 atttctcagcagggatgaacaaaaccagatgggagaagagc 185  Q
    |||||||| | || |||| ||||||||||||||||||||||    
21322531 atttctcaacgggaatgagcaaaaccagatgggagaagagc 21322491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 50899179 - 50899052
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    |||||||||||| ||| ||||||| ||||||||| ||| |  ||||||||||||||| | |||||||||||||||||| |||||||||||||| |  |||    
50899179 ttttgctcattcgcgttaaaatagtcgagcgtgacttagctaacgcaggtgtattcttaacgtgagttaactcacgcatgtgtatttctcagcggaaatg 50899080  T
162 aacaaaaccagatgggagaagagcaatt 189  Q
    | ||||| |||||| |||||||||||||    
50899079 agcaaaaacagatgagagaagagcaatt 50899052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 62 - 189
Target Start/End: Original strand, 29855950 - 29856078
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgta-tttctcagcagggat 160  Q
    |||||||||||||| ||||||||| ||||||||||||  | || |||  ||||||||||||  ||||||||||| ||||||||| ||||||||| |  ||    
29855950 ttttgctcattcccatcaaaatagtcgagcgtgagttgcctcaggcaaatgtattctcagcacgagttaactcatgcaggtgtattttctcagcggaaat 29856049  T
161 gaacaaaaccagatgggagaagagcaatt 189  Q
    || ||||| ||||| ||||||||||||||    
29856050 gagcaaaaacagattggagaagagcaatt 29856078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 49 - 148
Target Start/End: Complemental strand, 623000 - 622901
Alignment:
49 ttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    ||||||| |||  ||||||| || |||||||||||||| |||| ||||||||| | |||| ||||||| |||||||||||||||||||| ||||||||||    
623000 ttctcccatctgtttttgcttatccccgtcaaaatagctgagcctgagttaactcgcgcatgtgtattttcagcgtgagttaactcacgtaggtgtattt 622901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 38 - 191
Target Start/End: Original strand, 10369462 - 10369615
Alignment:
38 ggaaatggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    ||||||| |||||||  | || ||||||||||||| |||||||||| |  |||||||||||||| || |||| | |||||| | |||||||||||| |||    
10369462 ggaaatgactcttctttcatcaaattttgctcatttccgtcaaaatggttgagcgtgagttaactcatgcagatatattcttaacgtgagttaacttacg 10369561  T
138 caggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaattat 191  Q
     || || |||||||||   |||||||||||| || |||| |||  |||||||||    
10369562 aagatgcatttctcagtgcggatgaacaaaaacaaatggtagagaagcaattat 10369615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 154
Target Start/End: Original strand, 14210612 - 14210717
Alignment:
47 tcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtat 146  Q
    ||||||||| |||| |||||||||||||||||||| ||| |||| ||||||||||  |||||| || ||| ||| |||||||||||||||  ||||||||    
14210612 tcttctcccatcta-ttttgctcattcccgtcaaa-tagtcgagtgtgagttaacaaacgcagatgcattttcaacgtgagttaactcacataggtgtat 14210709  T
147 ttctcagc 154  Q
    || |||||    
14210710 ttttcagc 14210717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 32815881 - 32815754
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    ||||||||||| | |||||||||  | || ||||| |||| ||||||  |||||||||  |||||||||||||||||| ||||||||  |||  || |||    
32815881 ttttgctcatttctgtcaaaataatctagtgtgagctaactcacgcatatgtattctcgacgtgagttaactcacgcatgtgtattttccagtgggaatg 32815782  T
162 aacaaaaccagatgggagaagagcaatt 189  Q
    | ||||| |||||||||||||| |||||    
32815781 accaaaaacagatgggagaagaacaatt 32815754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 120 - 189
Target Start/End: Complemental strand, 52186930 - 52186861
Alignment:
120 agcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    ||||||||||||||||||||||||||||| ||||  || |||| ||||||  ||||||||||||||||||    
52186930 agcgtgagttaactcacgcaggtgtatttatcagtgggaatgagcaaaactggatgggagaagagcaatt 52186861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 62 - 135
Target Start/End: Original strand, 3851727 - 3851798
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactca 135  Q
    |||| ||||| ||||||||||||||||||||||||||||  | |||| ||||||| |||| |||||||||||||    
3851727 ttttcctcatccccgtcaaaatagccgagcgtgagttaa--ctcgcaagtgtattttcagtgtgagttaactca 3851798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 47 - 189
Target Start/End: Original strand, 27541176 - 27541317
Alignment:
47 tcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtat 146  Q
    ||||||||| |||  |||||| |||| |||| |||||| || ||||| ||||||  ||| || |||||||||||||||| |||||||||   ||||||||    
27541176 tcttctcccatctgtttttgcccatttccgttaaaatacccaagcgtaagttaagtcacacacgtgtattctcagcgtgggttaactca-taaggtgtat 27541274  T
147 ttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||| |   ||||| ||||| ||||||| |||||| |||||    
27541275 ttctcaacgaagatgagcaaaaacagatggaagaagaacaatt 27541317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 62 - 116
Target Start/End: Complemental strand, 52186957 - 52186903
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtatt 116  Q
    ||||||||| | || ||||||||||||||||||||||||| ||||||||||||||    
52186957 ttttgctcacttccatcaaaatagccgagcgtgagttaactcacgcaggtgtatt 52186903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Original strand, 48729056 - 48729105
Alignment:
104 acgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcag 153  Q
    ||||||||||||| |||||||||||||||||||||| |||||||| ||||    
48729056 acgcaggtgtattttcagcgtgagttaactcacgcatgtgtatttttcag 48729105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 139
Target Start/End: Original strand, 25571977 - 25572055
Alignment:
61 attttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgca 139  Q
    ||||| |||| |||||||||||||   ||||||||||||||  ||| || ||||||  |||||||||||||||||||||    
25571977 atttttctcactcccgtcaaaataattgagcgtgagttaacttacgtagatgtatttgcagcgtgagttaactcacgca 25572055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 123
Target Start/End: Original strand, 32827730 - 32827808
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcg 123  Q
    ||||||||||| |||  ||||||||||||| ||||||||||||||| ||  |||||| || ||| ||||||| ||||||    
32827730 gctcttctcccatctgtttttgctcattcctgtcaaaatagccgagtgtaggttaactcatgcatgtgtattttcagcg 32827808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 189
Target Start/End: Original strand, 30871942 - 30872019
Alignment:
112 gtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    ||||| || ||||||||||||| |  ||||||||||| ||| | ||||||| ||||| ||||||||||||||| ||||    
30871942 gtattttcggcgtgagttaacttatacaggtgtatttttcaactgggatgagcaaaaacagatgggagaagagtaatt 30872019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 93 - 135
Target Start/End: Original strand, 3393030 - 3393072
Alignment:
93 tgagttaacccacgcaggtgtattctcagcgtgagttaactca 135  Q
    ||||||||| |||| ||||||||| ||||||||||||||||||    
3393030 tgagttaactcacgtaggtgtattttcagcgtgagttaactca 3393072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 136
Target Start/End: Complemental strand, 31847763 - 31847698
Alignment:
71 ttcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcac 136  Q
    ||||||| |||||||| |||| ||||||||| |||||| ||| ||| | | |||||||||||||||    
31847763 ttcccgttaaaatagctgagcatgagttaactcacgcaagtgcatttttaccgtgagttaactcac 31847698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 3e-32; HSPs: 21)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 62 - 189
Target Start/End: Original strand, 42747102 - 42747228
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    ||||||| ||||||||||||||||  ||||||  |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||     ||    
42747102 ttttgctaattcccgtcaaaatagtagagcgtc-gttaactcacgcaggtgtattctcagcgtgagttaactcacgcatgtgtatttctcagcgaaagtg 42747200  T
162 aacaaaaccagatgggagaagagcaatt 189  Q
    | ||||||||||||||||||||||||||    
42747201 agcaaaaccagatgggagaagagcaatt 42747228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 47 - 189
Target Start/End: Original strand, 33648207 - 33648349
Alignment:
47 tcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtat 146  Q
    ||||||||| | || |||||||||||||||||||||||| |||| ||||||||||  |||||| |||||||||||||||||||||||  |||| ||||||    
33648207 tcttctcccatatatttttgctcattcccgtcaaaatagtcgagtgtgagttaactaacgcagatgtattctcagcgtgagttaacttgcgcatgtgtat 33648306  T
147 ttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    || ||||| |  |||| |||||  |||||| ||||||||||||    
33648307 ttttcagcggcaatgagcaaaaatagatggtagaagagcaatt 33648349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 76 - 189
Target Start/End: Complemental strand, 35947058 - 35946947
Alignment:
76 gtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatg 175  Q
    |||||||||| | ||||||||||||| |||| || |||||||||| | |||||||||||  |||||||||||| ||||||||||||| ||||| ||||||    
35947058 gtcaaaatagtcaagcgtgagttaactcacgtagatgtattctcaacatgagttaactc--gcaggtgtatttttcagcagggatgagcaaaatcagatg 35946961  T
176 ggagaagagcaatt 189  Q
    ||||||||||||||    
35946960 ggagaagagcaatt 35946947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 1845846 - 1845968
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    |||| |||||||||||||| |||| | |||||||||||||  | ||| ||||||||| ||  |||||||||||||||| ||||||||||||||||  |||    
1845846 tttttctcattcccgtcaatatagtcaagcgtgagttaacttatgcatgtgtattctgagtatgagttaactcacgcatgtgtatttctcagcagcaatg 1845945  T
162 aacaaaaccagatgggagaagag 184  Q
    | ||||| ||| |||||||||||    
1845946 agcaaaaacagttgggagaagag 1845968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 45 - 181
Target Start/End: Complemental strand, 684290 - 684154
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||| | | || ||||| |||||||||| ||||||| ||||| ||||||||| ||||||| |||||||||| ||||| |||||||||  || |||    
684290 gctcttctctcgtatatttttgttcattcccgttaaaatagtcgagcatgagttaactcacgcagatgtattctcatcgtgaattaactcacatagatgt 684191  T
145 atttctcagcagggatgaacaaaaccagatgggagaa 181  Q
    |||||||| |||  |||||||||| || ||| |||||    
684190 atttctcaacagaaatgaacaaaagcatatgagagaa 684154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 62 - 174
Target Start/End: Original strand, 53979037 - 53979149
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    ||||||||||||| || ||||||| ||| ||||||||||| ||| || ||||||| |||||||||||||||||| ||| ||||||||||||   || |||    
53979037 ttttgctcattcctgttaaaatagtcgaacgtgagttaactcacacatgtgtattttcagcgtgagttaactcaagcatgtgtatttctcaatgggaatg 53979136  T
162 aacaaaaccagat 174  Q
    ||||||| |||||    
53979137 aacaaaatcagat 53979149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 68 - 162
Target Start/End: Original strand, 16962847 - 16962941
Alignment:
68 tcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatga 162  Q
    |||||||  ||||||||| ||||||||||||||| |||| || |||||| |||| ||||||| ||| |||||  |||||||||||||||| ||||    
16962847 tcattcctatcaaaatagtcgagcgtgagttaactcacgtagatgtattttcagtgtgagttgacttacgcatatgtatttctcagcaggaatga 16962941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 62 - 148
Target Start/End: Complemental strand, 37182309 - 37182223
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||||||| ||||| |||||||| |||||||| ||||||| ||| || ||| ||| ||| |||||||||||||||| ||||||||||    
37182309 ttttgctcgttcccatcaaaataaccgagcgtaagttaactcacacatgtgcattttcaacgtgagttaactcacgtaggtgtattt 37182223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 52450218 - 52450149
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaa 131  Q
    |||| ||||||||||||||||||||||||||||||||||| || |||| | |||| ||| ||||||||||    
52450218 ttttactcattcccgtcaaaatagccgagcgtgagttaactcaagcagttatattttcaacgtgagttaa 52450149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 153
Target Start/End: Original strand, 50136475 - 50136582
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |  | |||||||||||||||||||| ||||||||||| ||||| |   |||||||||||| ||||  |||||||||||||  ||||||    
50136475 gctcttctcccattaatttttgctcattcccgtcaaa-tagccgagcgtaagttatcatgcgcaggtgtattttcagtttgagttaactcacataggtgt 50136573  T
145 atttctcag 153  Q
    |||| ||||    
50136574 atttttcag 50136582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 45800306 - 45800248
Alignment:
74 ccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaac 132  Q
    |||||| ||||| |||||| |||||||||||||||  ||||||||||||||||||||||    
45800306 ccgtcataatagtcgagcgagagttaacccacgcacatgtattctcagcgtgagttaac 45800248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 137
Target Start/End: Original strand, 959088 - 959179
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    ||||||||||| |||| ||||||||||| |||| ||| ||  ||||||| |||||||  | ||||||||||| ||||||| ||||||||||||    
959088 gctcttctcccatctatttttgctcatttccgttaaa-taatcgagcgtcagttaactgatgcaggtgtattttcagcgtaagttaactcacg 959179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 148
Target Start/End: Original strand, 21326264 - 21326349
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||| |||||||| ||||||||||||||  |  || |||| ||||||| |||||||||||| |||||||| ||||| ||||||||||    
21326264 tttttctcattcctgtcaaaatagccgactga-agctaactcacgcagatgtattctcagcatgagttaaatcacgtaggtgtattt 21326349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 116
Target Start/End: Complemental strand, 29405196 - 29405126
Alignment:
46 ctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtatt 116  Q
    |||||||||| | | |||||| ||||| |||||||||||||||||||||||| ||| ||| || |||||||    
29405196 ctcttctcccatatgattttgttcatttccgtcaaaatagccgagcgtgagtgaactcacacatgtgtatt 29405126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 137
Target Start/End: Original strand, 6083690 - 6083762
Alignment:
64 ttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    |||||| |||||||||||| || | || |||||||||| |||||||||| ||| || |||||||||||||||||    
6083690 ttgctcgttcccgtcaaaa-agtcaagtgtgagttaactcacgcaggtgcattttcggcgtgagttaactcacg 6083762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 135
Target Start/End: Original strand, 36138956 - 36139029
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactca 135  Q
    |||| ||||||| ||||||||||  ||| ||||||||||| |||||| ||| ||| ||| ||||||||||||||    
36138956 tttttctcattctcgtcaaaataagcgaacgtgagttaactcacgcatgtgcattttcaacgtgagttaactca 36139029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 135
Target Start/End: Complemental strand, 56211026 - 56210954
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactca 135  Q
    ||||||||||| ||||||||||||| || ||||||||||| ||| |  ||||||| ||| ||||||||||||||    
56211026 ttttgctcatttccgtcaaaatagctga-cgtgagttaactcacacgtgtgtattttcaacgtgagttaactca 56210954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 21027971 - 21027915
Alignment:
38 ggaaatggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtg 94  Q
    ||||||| |||||||||| |||  ||||||||||||| |||||||||||| ||||||    
21027971 ggaaatgactcttctcccatctgtttttgctcattcctgtcaaaatagccaagcgtg 21027915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 100
Target Start/End: Original strand, 24393615 - 24393670
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaa 100  Q
    ||||||||||| |||  |||||||||||||| |||||||||  |||||||||||||    
24393615 gctcttctcccatctgtttttgctcattcccatcaaaatagttgagcgtgagttaa 24393670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 21027892 - 21027851
Alignment:
148 tctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    ||||||| ||||||||||||| ||||||||||||||| ||||    
21027892 tctcagcggggatgaacaaaaacagatgggagaagagtaatt 21027851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 148
Target Start/End: Original strand, 30211943 - 30212012
Alignment:
79 aaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||||| |||||| ||||||||| ||| || ||| ||| ||| |||||||||||||||| ||||| ||||    
30211943 aaaataaccgagcatgagttaactcacacatgtgcattttcaacgtgagttaactcacgtaggtgcattt 30212012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 2e-27; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 34072977 - 34072852
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    |||||||||||||||| ||||||| ||||| ||||||||| |||| |||||||||||||||||||||||||| ||||| |||||||| ||||| || | |    
34072977 ttttgctcattcccgttaaaataggcgagcatgagttaactcacgtaggtgtattctcagcgtgagttaacttacgcaagtgtatttttcagc-ggaacg 34072879  T
162 aacaaaaccagatgggagaagagcaatt 189  Q
    | |||||  |||||||||||||||||||    
34072878 agcaaaa-aagatgggagaagagcaatt 34072852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 62 - 148
Target Start/End: Original strand, 43846273 - 43846359
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    ||||| ||| |||||| ||||||| ||||||||||||||| |||||| || ||||||||||  ||||||||||||||||||||||||    
43846273 ttttgttcactcccgttaaaatagtcgagcgtgagttaactcacgcatgtatattctcagcaagagttaactcacgcaggtgtattt 43846359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 45 - 153
Target Start/End: Complemental strand, 38006619 - 38006505
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagt------taacccacgcaggtgtattctcagcgtgagttaactcacgc 138  Q
    ||||||||||| |||  |||||||||||||||| ||||||| |||||||||||      |||| |||| | ||||||| |||| ||||||||||||||||    
38006619 gctcttctcccatctgtttttgctcattcccgttaaaatagtcgagcgtgagttaatgctaactcacgtatgtgtattttcagggtgagttaactcacgc 38006520  T
139 aggtgtatttctcag 153  Q
    || ||||||||||||    
38006519 agatgtatttctcag 38006505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 45 - 154
Target Start/End: Original strand, 12750161 - 12750270
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||  |||| ||||| |||||| |||||||||||||||||||||| |||||||||||||| |||| | || |||||| ||| | | ||    
12750161 gctcttctcccatctgtttttcctcatccccgtccaaatagccgagcgtgagttaactcacgcaggtgtattttcagtgcgaattaacttacgtaagcgt 12750260  T
145 atttctcagc 154  Q
    |||| |||||    
12750261 atttttcagc 12750270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 33102150 - 33102104
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgca 108  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||    
33102150 ttttgctcattcccgtcaaaatagccgagcgtgagttaactcacgca 33102104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 35690634 - 35690507
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaaccca-cgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggat 160  Q
    |||||||||||| | ||||||||| ||||||||| ||||| || | ||| |||| |||||||||||||||||||| |||  || ||||||||  |   ||    
35690634 ttttgctcattctcatcaaaatagtcgagcgtgaattaactcaccccagatgtagtctcagcgtgagttaactcatgca-atgaatttctcaataaaaat 35690536  T
161 gaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||| |||||||||||| |||||||    
35690535 gaacaaaaacagatgggagaaaagcaatt 35690507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 189
Target Start/End: Original strand, 8983761 - 8983839
Alignment:
110 gtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||||||||||||||||||||||| |  ||||||||||||| || |||| |||||  |||| ||||||||||||||    
8983761 gtgtattctcagcgtgagttaactcacgtaaatgtatttctcagcgggaatgagcaaaaagagat-ggagaagagcaatt 8983839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 116
Target Start/End: Complemental strand, 33581914 - 33581843
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtatt 116  Q
    |||||||| || ||| |||||||||||||||  |||||||||| ||||||||||||| |||||||| |||||    
33581914 gctcttcttccatctgattttgctcattcccaacaaaatagcctagcgtgagttaactcacgcaggagtatt 33581843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 47 - 106
Target Start/End: Original strand, 22842156 - 22842215
Alignment:
47 tcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacg 106  Q
    ||||||||| |||  |||| ||||||||||||||||||| ||||||||||||||| ||||    
22842156 tcttctcccatctgttttttctcattcccgtcaaaatagtcgagcgtgagttaactcacg 22842215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 101
Target Start/End: Original strand, 3434792 - 3434831
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaac 101  Q
    |||||||||||||| ||||||||||||||||||| |||||    
3434792 ttttgctcattcccatcaaaatagccgagcgtgaattaac 3434831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 116
Target Start/End: Original strand, 7913312 - 7913366
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtatt 116  Q
    ||||||||||| ||||||||||||  |||||||||||||| ||| || |||||||    
7913312 ttttgctcatttccgtcaaaatagttgagcgtgagttaacacacacatgtgtatt 7913366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 5995106 - 5995191
Alignment:
49 ttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactc 134  Q
    ||||||| |||| |||||||| ||||||| |||||||   | | ||||||||| |||||| ||||||| ||  |||||||||||||    
5995106 ttctcccatctatttttgctcgttcccgttaaaatagtacaacatgagttaactcacgcatgtgtattttcgacgtgagttaactc 5995191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 2e-27; HSPs: 11)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 94 - 189
Target Start/End: Original strand, 28228862 - 28228957
Alignment:
94 gagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||| |||||| ||||||||||| |||||||||||| ||||| |||||||||||||| | ||||||||||| ||||||||||||||||||||    
28228862 gagttaactcacgcatgtgtattctcatcgtgagttaacttacgcatgtgtatttctcagcggagatgaacaaaaacagatgggagaagagcaatt 28228957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 90 - 189
Target Start/End: Original strand, 28217976 - 28218075
Alignment:
90 gcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||||||| |||||||||||||||||| |||||||||||| ||||| |||||||||||| | | ||||| ||||| || |||| ||||||||||||    
28217976 gcgtgagttaactcacgcaggtgtattctcatcgtgagttaacttacgcatgtgtatttctcaacggtgatgagcaaaaacatatggaagaagagcaatt 28218075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 45 - 136
Target Start/End: Original strand, 32303614 - 32303705
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcac 136  Q
    |||||||| || ||| ||||||||||||  ||||||||||| ||||||||||||||| |||||| ||||||| |||||||||||||||||||    
32303614 gctcttcttccatctgattttgctcattttcgtcaaaatagtcgagcgtgagttaactcacgcatgtgtattttcagcgtgagttaactcac 32303705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 45 - 154
Target Start/End: Complemental strand, 37442669 - 37442561
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    |||||||| || |||  |||||||||||||||||||| ||||||||||||||||||| || |||| |||||| ||| | |||||||||||||| ||||||    
37442669 gctcttcttccatctgtttttgctcattcccgtcaaa-tagccgagcgtgagttaactcatgcagatgtattttcaacatgagttaactcacgtaggtgt 37442571  T
145 atttctcagc 154  Q
    |||| |||||    
37442570 atttttcagc 37442561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 45 - 154
Target Start/End: Original strand, 9828186 - 9828293
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||  ||||||||||||||||| ||||||  |||||||||||||||||| || ||||||| ||||  |||||||||||||| ||||||    
9828186 gctcttctcccatctggttttgctcattcccgtc-aaatagtagagcgtgagttaacccacacaagtgtattttcag-atgagttaactcacgtaggtgt 9828283  T
145 atttctcagc 154  Q
    |||| |||||    
9828284 atttttcagc 9828293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 148
Target Start/End: Complemental strand, 9979735 - 9979634
Alignment:
47 tcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtat 146  Q
    ||||||||| |||  ||||| ||||||  |||||||||| |||||||||||||||  |||||| |||||||||||| | |||||||| || || ||||||    
9979735 tcttctcccatctgtttttgttcattcatgtcaaaatagtcgagcgtgagttaacttacgcagatgtattctcagcataagttaactgacacatgtgtat 9979636  T
147 tt 148  Q
    ||    
9979635 tt 9979634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 42924006 - 42923914
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagc 154  Q
    |||| ||| ||||| |||||||| |||| |||| |||||| || ||||||| ||| ||| |||||||||||||| ||| || ||||| |||||    
42924006 ttttactcgttcccttcaaaataaccgaacgtgtgttaactcatgcaggtgcattttcaacgtgagttaactcatgcatgtatatttttcagc 42923914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 157
Target Start/End: Complemental strand, 36781114 - 36781019
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagg 157  Q
    |||| |||||| |||||||||||| |||| || ||||||  |||| |  | ||||||||||||||||||| ||||| | || ||||| ||||||||    
36781114 tttttctcatttccgtcaaaatagtcgagtgtcagttaattcacgtaaatatattctcagcgtgagttaattcacgtatgtatatttttcagcagg 36781019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 192
Target Start/End: Complemental strand, 9828212 - 9828179
Alignment:
159 atgaacaaaaccagatgggagaagagcaattatc 192  Q
    |||| |||||||||||||||||||||||||||||    
9828212 atgagcaaaaccagatgggagaagagcaattatc 9828179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 139
Target Start/End: Complemental strand, 28228875 - 28228826
Alignment:
90 gcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgca 139  Q
    |||||||||||| | |||| ||||||||||| |||||||||||| |||||    
28228875 gcgtgagttaactcgcgcatgtgtattctcatcgtgagttaacttacgca 28228826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 32827124 - 32827028
Alignment:
57 tctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagc 154  Q
    |||| ||||||||||| ||||| |||||| ||| | ||||||||| ||| || ||||||| ||| ||||||  |||||| | |||||||||| |||||    
32827124 tctatttttgctcatttccgtc-aaatagtcgaacatgagttaactcacacaagtgtattttcaacgtgagaaaactcatgtaggtgtatttttcagc 32827028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 59; Significance: 1e-24; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 46 - 189
Target Start/End: Complemental strand, 31756919 - 31756774
Alignment:
46 ctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtga--gttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtg 143  Q
    |||||||||| |||  ||||||||||| |||| |||||||  ||| ||||  |||||| ||||||| | ||||||||||||||||||||||| |||||||    
31756919 ctcttctcccatctgtttttgctcatttccgtaaaaatagttgagtgtgatagttaactcacgcagatatattctcagcgtgagttaactcatgcaggtg 31756820  T
144 tatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    ||||| ||||  || |||| |||||  |||||||||||||||||||    
31756819 tatttttcagtcggaatgagcaaaaatagatgggagaagagcaatt 31756774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 45 - 150
Target Start/End: Original strand, 3756381 - 3756486
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| | |  |||||||||||||||||||||||| |||| |||||||||| |  ||| ||| |||||||||||||||||||||| | ||||||    
3756381 gctcttctcccatttgtttttgctcattcccgtcaaaatagtcgagtgtgagttaactcgtgcaagtggattctcagcgtgagttaactcatgtaggtgt 3756480  T
145 atttct 150  Q
    ||||||    
3756481 atttct 3756486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 16862775 - 16862859
Alignment:
105 cgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||     || |||| ||||| |||||||||||| |||||||    
16862775 cgcatgtgtattctctgcgtgagttaactcacgcaggtgtatttcttgatgggaatgagcaaaaacagatgggagaaaagcaatt 16862859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 192
Target Start/End: Original strand, 30755727 - 30755796
Alignment:
123 gtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaattatc 192  Q
    ||||||||||||| ||| || |||||||||||||| |||| ||||| |||||  ||||||||||||||||    
30755727 gtgagttaactcatgcatgtatatttctcagcaggaatgagcaaaaacagataagagaagagcaattatc 30755796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 95
Target Start/End: Complemental strand, 9902225 - 9902174
Alignment:
44 ggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtga 95  Q
    |||||||||||| |||  |||||||||||||||||||||||  |||||||||    
9902225 ggctcttctcccatctgtttttgctcattcccgtcaaaataatcgagcgtga 9902174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 176
Target Start/End: Original strand, 48967665 - 48967801
Alignment:
44 ggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgt----attctcagcgtgagttaactcacgca 139  Q
    |||||||||||| |||  || || |||||||||||||||| | |||| || ||||||| |||  | ||||    ||||||||||||||| ||| ||| ||    
48967665 ggctcttctcccatctgtttatgttcattcccgtcaaaattgtcgagggtaagttaactcacataagtgtgtgtattctcagcgtgagtcaacacacaca 48967764  T
140 ggtgtatttctcagcagggatgaacaaaaccagatgg 176  Q
     |||||||||||||| |  || ||||||| |||||||    
48967765 agtgtatttctcagcggaaataaacaaaaacagatgg 48967801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 136
Target Start/End: Complemental strand, 33818999 - 33818925
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcac 136  Q
    |||||||||| ||||||||| ||| ||| ||||||||||| || ||| ||||||| | |||| || |||||||||    
33818999 ttttgctcatccccgtcaaagtaggcgaacgtgagttaactcatgcatgtgtatttttagcgcgaattaactcac 33818925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 155
Target Start/End: Complemental strand, 41909421 - 41909312
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||| | |||  |||| ||||||||||||||| ||  | ||||| ||||||| |||||| || |||| ||| ||| |||||||||||||| || |    
41909421 gctcttctctcatctgttttttctcattcccgtcaaa-taatcaagcgtaagttaactcacgcatgtatattttcaacgtaagttaactcacgcaagtat 41909323  T
145 atttctcagca 155  Q
    |||| ||||||    
41909322 atttttcagca 41909312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 2e-23; HSPs: 13)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 45 - 189
Target Start/End: Original strand, 3644739 - 3644883
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||| | |||| |||||||||||| |||||||||||   |||||||||||||  | ||||||||||| |||| ||||||||||| || || || |    
3644739 gctcttctctcatctatttttgctcattctcgtcaaaatagttaagcgtgagttaacttatgcaggtgtattttcagtgtgagttaacttacacatgtct 3644838  T
145 atttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||||| |  |||| ||||| ||||||||||||| ||||||    
3644839 atttctcagcggaaatgagcaaaatcagatgggagaagtgcaatt 3644883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 46 - 154
Target Start/End: Complemental strand, 28992527 - 28992419
Alignment:
46 ctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgta 145  Q
    |||||||||| |||  |||||||||||||||| ||||||| ||| ||||| ||||| ||| || ||||||| |||||||||||||||||||| | |||||    
28992527 ctcttctcccatctggttttgctcattcccgttaaaatagacgatcgtgatttaactcacacatgtgtattttcagcgtgagttaactcacgtatgtgta 28992428  T
146 tttctcagc 154  Q
    ||| |||||    
28992427 tttttcagc 28992419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 45 - 113
Target Start/End: Complemental strand, 2725906 - 2725838
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgt 113  Q
    ||||||||||| |||  |||||||||||||||||||||||||||||||||||||||| |||||| ||||    
2725906 gctcttctcccatctgtttttgctcattcccgtcaaaatagccgagcgtgagttaactcacgcaagtgt 2725838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 23252948 - 23252896
Alignment:
49 ttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaac 101  Q
    ||||||| |||  ||||||||||||||||||||||||||||||||||||||||    
23252948 ttctcccatctggttttgctcattcccgtcaaaatagccgagcgtgagttaac 23252896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 144
Target Start/End: Original strand, 2146736 - 2146834
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||| ||||||| ||| |||||||| |||| |||||||||| ||| |||||| ||||| | ||| |||||||||||| ||| ||||||    
2146736 gctcttctcccatctatttttgcttatttccgtcaaa-tagcagagcgtgagtgaactcacgcatgtgtaatttcaacgtgagttaacttacgtaggtgt 2146834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 148
Target Start/End: Complemental strand, 3607112 - 3607010
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||| |||||||||||  ||| |||||||  |||||||| || || |||||| ||||||| | | |||||||||||||||| ||||||    
3607112 gctcttctcccatctatttttgctcattttcgt-aaaatagttgagcgtgaattgactcacgcatgtgtatttttaacgtgagttaactcacgtaggtgt 3607014  T
145 attt 148  Q
    ||||    
3607013 attt 3607010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 189
Target Start/End: Complemental strand, 2725862 - 2725793
Alignment:
120 agcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaaccagatgggagaagagcaatt 189  Q
    |||||||||||||||||||| |||| ||||||||| || |||| |||||  |||||  ||||||||||||    
2725862 agcgtgagttaactcacgcaagtgtgtttctcagcgggaatgagcaaaaaaagatgtaagaagagcaatt 2725793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 135
Target Start/End: Original strand, 2744134 - 2744207
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactca 135  Q
    |||||||| |||||||||||||| | || ||||||||||| |||||| ||| ||| | | ||||||||||||||    
2744134 ttttgctcgttcccgtcaaaataacagaacgtgagttaactcacgcatgtgcatttttaacgtgagttaactca 2744207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 148
Target Start/End: Complemental strand, 3789003 - 3788927
Alignment:
72 tcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||||||||||||||||||| | |||||||  ||||| |  |||| |||| ||||||||||| ||| ||||||||||    
3789003 tcccgtcaaaatagccgagcataagttaacttacgcaagaatattttcagtgtgagttaacttacgtaggtgtattt 3788927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 108
Target Start/End: Original strand, 35187909 - 35187956
Alignment:
61 attttgctcattcccgtcaaaatagccgagcgtgagttaacccacgca 108  Q
    ||||||||||||||||| ||||||| ||| ||||||||||| ||||||    
35187909 attttgctcattcccgttaaaatagtcgaccgtgagttaactcacgca 35187956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 152
Target Start/End: Original strand, 1791949 - 1792039
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctca 152  Q
    ||||| ||||| |||||||||| | ||| ||||||||||| || |||  |||||||||| ||||| |||||   |||| ||||||||||||    
1791949 ttttgttcatttccgtcaaaattgtcgaacgtgagttaactcatgcaaatgtattctcaacgtgaattaaccggcgcatgtgtatttctca 1792039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 148
Target Start/End: Complemental strand, 5076576 - 5076519
Alignment:
92 gtgagttaacccacgcaggtgt-attctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||||||||| || |||||||| || | ||||||||||||||||||||||| ||||||    
5076576 gtgagttaactcatgcaggtgttatacccagcgtgagttaactcacgcaggagtattt 5076519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 33699322 - 33699371
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggt 111  Q
    |||||||  |||||||||||||||  |||||||||||||| |||||||||    
33699322 ttttgcttgttcccgtcaaaataggtgagcgtgagttaactcacgcaggt 33699371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 1e-21; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 62 - 194
Target Start/End: Original strand, 6620026 - 6620156
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatg 161  Q
    ||||||||||||||||||||||||  |||||||||||||| || |||||||||||||| |  ||||||||||||||||   ||||||||||| |   |||    
6620026 ttttgctcattcccgtcaaaatagttgagcgtgagttaactcatgcaggtgtattctctgtatgagttaactcacgca--agtatttctcagtaaaaatg 6620123  T
162 aacaaaaccagatgggagaagagcaattatcca 194  Q
    | ||||| ||||| |||||| ||||||| ||||    
6620124 agcaaaaacagataggagaaaagcaattctcca 6620156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 45 - 150
Target Start/End: Original strand, 44540666 - 44540771
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||| | |||  ||||||| |||||||||||||||| |||| | |||||||  |||||| ||||||||||| |||||||||||||||||| ||||    
44540666 gctcttctctcatctgtttttgcttattcccgtcaaaatagtcgagagcgagttaattcacgcatgtgtattctcaacgtgagttaactcacgcatgtgt 44540765  T
145 atttct 150  Q
    ||||||    
44540766 atttct 44540771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 45 - 154
Target Start/End: Complemental strand, 32016541 - 32016431
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacc-cacgcaggtgtattctcagcgtgagttaactcacgcaggtg 143  Q
    ||||||||||| |||| |||| ||| ||||| ||||||||| | |||||||||||| | |||||||||||||| | | |||||||||||||||| |||||    
32016541 gctcttctcccatctatttttactcgttcccatcaaaatagtccagcgtgagttaaactcacgcaggtgtatttttaacgtgagttaactcacgtaggtg 32016442  T
144 tatttctcagc 154  Q
    ||||| |||||    
32016441 tatttttcagc 32016431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 33833512 - 33833422
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcac 136  Q
    ||||||||||| |||  |||| |||||||| |||||| |||||||||||| |||||| || ||||||||||| | | |||||||||||||||    
33833512 gctcttctcccatctgtttttactcattcctgtcaaa-tagccgagcgtgggttaactcatgcaggtgtatttttaacgtgagttaactcac 33833422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 68 - 137
Target Start/End: Original strand, 13387346 - 13387415
Alignment:
68 tcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    |||||||||||||||||| | ||||||||||||| |||| | ||||||| ||| | ||||||||||||||    
13387346 tcattcccgtcaaaatagtcaagcgtgagttaactcacgtatgtgtattttcatcatgagttaactcacg 13387415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 84 - 168
Target Start/End: Original strand, 37426851 - 37426933
Alignment:
84 agccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtatttctcagcagggatgaacaaaa 168  Q
    |||||||||||||||||| |||| ||||||||||||  || |||||||||||  || |||||||||| |||||| |||| |||||    
37426851 agccgagcgtgagttaactcacgtaggtgtattctcgacgagagttaactca--catgtgtatttctaagcaggaatgagcaaaa 37426933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 44069891 - 44069939
Alignment:
89 agcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacg 137  Q
    ||||||||||||| |||||||||||||| ||| ||||||||||||||||    
44069891 agcgtgagttaactcacgcaggtgtattttcaacgtgagttaactcacg 44069939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 61 - 148
Target Start/End: Complemental strand, 39556063 - 39555977
Alignment:
61 attttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgtattt 148  Q
    |||||||||||||||||| |||||| |||| |||||||||| |||||| ||||| | | |  ||||||| ||||||| ||||||||||    
39556063 attttgctcattcccgtc-aaatagtcgagtgtgagttaactcacgcatgtgtaattttaaagtgagttgactcacgtaggtgtattt 39555977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0325
Description:

Target: scaffold0325; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 116
Target Start/End: Original strand, 14658 - 14730
Alignment:
44 ggctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtatt 116  Q
    ||||||||||||  | ||||||||||||||||  |||||||||| ||||||||||||| |||||||| |||||    
14658 ggctcttctcccgacaaattttgctcattcccaacaaaatagcctagcgtgagttaactcacgcaggagtatt 14730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 144
Target Start/End: Original strand, 23197 - 23295
Alignment:
45 gctcttctcccttctaattttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgtattctcagcgtgagttaactcacgcaggtgt 144  Q
    ||||||||||| |||| ||||||| ||| |||||||| |||| |||||||||| ||| |||||| ||||| | ||| |||||||||||| ||| ||||||    
23197 gctcttctcccatctatttttgcttatttccgtcaaa-tagcagagcgtgagtgaactcacgcatgtgtaatttcaacgtgagttaacttacgtaggtgt 23295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 137
Target Start/End: Complemental strand, 130786 - 130711
Alignment:
62 ttttgctcattcccgtcaaaatagccgagcgtgagttaacccacgcaggtgta-ttctcagcgtgagttaactcacg 137  Q
    ||||| |||||||||||||| || |||| ||||||||||| |||||||||||| || |||| |||||||||||||||    
130786 ttttgttcattcccgtcaaa-taaccgaacgtgagttaactcacgcaggtgtatttttcagtgtgagttaactcacg 130711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149692 times since January 2019
Visitors: 1517