View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_10 (Length: 359)

Name: NF1565_high_10
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_10
NF1565_high_10
[»] chr6 (1 HSPs)
chr6 (1-354)||(898312-898663)


Alignment Details
Target: chr6 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 898312 - 898663
Alignment:
1 acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
898312 acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga 898411  T
101 cacaaccaaggtcggttttacctgaattttgacatagagaggtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata 200  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
898412 cacaaccaaggtcggttttacctgaattttgacatagag--gtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata 898509  T
201 attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
898510 attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat 898609  T
301 taaagtttacacaacatctcgtctttgatgtcactctctgagattttcttcgac 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
898610 taaagtttacacaacatctcgtctttgatgtcactctctgagattttgttcgac 898663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142455 times since January 2019
Visitors: 1480