View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_high_10 (Length: 359)
Name: NF1565_high_10
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 898312 - 898663
Alignment:
Q |
1 |
acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
898312 |
acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga |
898411 |
T |
 |
Q |
101 |
cacaaccaaggtcggttttacctgaattttgacatagagaggtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
898412 |
cacaaccaaggtcggttttacctgaattttgacatagag--gtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata |
898509 |
T |
 |
Q |
201 |
attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
898510 |
attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat |
898609 |
T |
 |
Q |
301 |
taaagtttacacaacatctcgtctttgatgtcactctctgagattttcttcgac |
354 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
898610 |
taaagtttacacaacatctcgtctttgatgtcactctctgagattttgttcgac |
898663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 142455 times since January 2019
Visitors: 1480