View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_high_11 (Length: 339)
Name: NF1565_high_11
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 7375673 - 7375950
Alignment:
Q |
1 |
atgccaaacacagacataatggtttcatttgatgacttttgctttctttaatgatcttgtttttgtaatgaattt-gtt--ctctcaatcatgtgtttat |
97 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
7375673 |
atgccaaacacagacataatggttgcatttgatgacttttgctttgtttaatgatcttgtctttgtaatgaattttgttgtctctcaatcatgtgtttat |
7375772 |
T |
 |
Q |
98 |
tgtgatcaatgtaactaacttcaatgaaagtggcttccaaactctcttgacaagtgatggatcataaaattcagccaacagcaaagtaactgttgaggtt |
197 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
7375773 |
tgtgatcaatgtaactaacttcaaagaaagtggcttccaaattctcttgacaagtgatggatcataaaattcagccaacagcaaagtaacag-------- |
7375864 |
T |
 |
Q |
198 |
ttcaattattcaaatatagtgctacagattacaacttcatattaaaaattacgtctcatttttgtgtattcagcttgataatatcaaataaatgat |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7375865 |
----------caaatatagtgctacagattacaacttcatattaaaaactacgtctcatttttgtgtattcagcttgataatatcaaataaatgat |
7375950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 7278166 - 7278029
Alignment:
Q |
1 |
atgccaaacacagacataatggtttcatttgatgacttttgctttctttaatgatcttgtttttgtaatgaa-tttgt--tctctcaatcatgtgtttat |
97 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
T |
7278166 |
atgccaaacacagacataatggttgcatttgatgacttttgctttgtttaatgatcttgtctttgtaatgaattttgttgtctctcaatcatgtgtttat |
7278067 |
T |
 |
Q |
98 |
tgtg--atcaatgtaactaacttcaatgaaagtggctt |
133 |
Q |
|
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
T |
7278066 |
tgtgatatcagtgtaactaacttcaatgaaagtggctt |
7278029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 141837 times since January 2019
Visitors: 1478