View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_13 (Length: 321)

Name: NF1565_high_13
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_13
[»] chr7 (37 HSPs)
chr7 (7-118)||(14108829-14108940)
chr7 (7-118)||(14418786-14418897)
chr7 (121-237)||(45087067-45087183)
chr7 (119-237)||(45088192-45088310)
chr7 (116-237)||(45596866-45596988)
chr7 (110-176)||(21709149-21709215)
chr7 (29-116)||(40930653-40930740)
chr7 (120-176)||(26024888-26024944)
chr7 (117-176)||(21710602-21710661)
chr7 (29-116)||(38406266-38406350)
chr7 (29-69)||(4167785-4167825)
chr7 (114-178)||(19069951-19070015)
chr7 (118-178)||(36701357-36701417)
chr7 (110-178)||(40852159-40852227)
chr7 (119-178)||(23350915-23350974)
chr7 (115-178)||(24733625-24733688)
chr7 (70-116)||(4167700-4167746)
chr7 (110-172)||(19543481-19543543)
chr7 (116-178)||(39143510-39143572)
chr7 (116-178)||(48095361-48095423)
chr7 (117-178)||(3217753-3217814)
chr7 (117-178)||(7776956-7777017)
chr7 (117-178)||(8736123-8736184)
chr7 (119-176)||(10986695-10986752)
chr7 (117-178)||(13965038-13965099)
chr7 (119-160)||(26025883-26025924)
chr7 (117-178)||(27284240-27284301)
chr7 (119-172)||(39383805-39383858)
chr7 (119-172)||(40738193-40738246)
chr7 (117-178)||(45057539-45057600)
chr7 (117-178)||(47987325-47987386)
chr7 (110-178)||(19105598-19105666)
chr7 (118-178)||(20493744-20493804)
chr7 (118-178)||(31852081-31852141)
chr7 (118-178)||(36701739-36701799)
chr7 (118-178)||(37374456-37374516)
chr7 (118-178)||(45456733-45456793)
[»] scaffold0029 (2 HSPs)
scaffold0029 (119-237)||(71769-71887)
scaffold0029 (118-237)||(70668-70788)
[»] scaffold0394 (1 HSPs)
scaffold0394 (117-232)||(14268-14384)
[»] chr3 (31 HSPs)
chr3 (116-232)||(27688483-27688599)
chr3 (117-232)||(27695520-27695635)
chr3 (117-209)||(20184446-20184538)
chr3 (118-232)||(20185758-20185872)
chr3 (121-235)||(39991507-39991620)
chr3 (110-176)||(39992495-39992561)
chr3 (108-176)||(21815897-21815965)
chr3 (117-178)||(49221505-49221566)
chr3 (120-176)||(21817401-21817457)
chr3 (111-178)||(45940679-45940746)
chr3 (117-178)||(12061622-12061683)
chr3 (117-178)||(18024916-18024977)
chr3 (114-178)||(12739959-12740023)
chr3 (116-172)||(32304229-32304285)
chr3 (109-172)||(13355165-13355228)
chr3 (117-176)||(14859134-14859193)
chr3 (111-170)||(22976973-22977032)
chr3 (119-178)||(38771617-38771676)
chr3 (119-178)||(40503731-40503790)
chr3 (108-178)||(17934081-17934151)
chr3 (114-171)||(966975-967032)
chr3 (192-237)||(5348837-5348881)
chr3 (115-172)||(13301961-13302018)
chr3 (115-172)||(13312617-13312674)
chr3 (115-172)||(19794780-19794837)
chr3 (117-178)||(24242996-24243057)
chr3 (117-178)||(28004264-28004325)
chr3 (119-176)||(43464812-43464869)
chr3 (117-178)||(51891299-51891360)
chr3 (138-178)||(8327766-8327806)
chr3 (122-178)||(31049077-31049133)
[»] chr6 (35 HSPs)
chr6 (118-232)||(29751085-29751199)
chr6 (119-232)||(29744781-29744894)
chr6 (117-227)||(14403686-14403796)
chr6 (117-176)||(21611913-21611972)
chr6 (29-114)||(33801796-33801882)
chr6 (118-176)||(21282816-21282874)
chr6 (119-176)||(5660192-5660249)
chr6 (121-176)||(5659106-5659162)
chr6 (115-158)||(21283922-21283965)
chr6 (125-176)||(21612882-21612933)
chr6 (116-178)||(8938883-8938945)
chr6 (108-178)||(19048233-19048303)
chr6 (113-178)||(8286689-8286754)
chr6 (119-178)||(3618781-3618840)
chr6 (111-178)||(5645865-5645932)
chr6 (115-178)||(8286307-8286370)
chr6 (117-172)||(12260444-12260499)
chr6 (119-178)||(18700401-18700460)
chr6 (119-178)||(26841605-26841664)
chr6 (119-172)||(5645546-5645599)
chr6 (117-178)||(6888781-6888842)
chr6 (113-178)||(21272118-21272183)
chr6 (117-178)||(26392844-26392905)
chr6 (118-151)||(29465754-29465787)
chr6 (119-172)||(31038321-31038374)
chr6 (109-178)||(32223834-32223903)
chr6 (114-178)||(3366493-3366557)
chr6 (114-178)||(12261489-12261553)
chr6 (114-178)||(13703376-13703440)
chr6 (118-178)||(17383734-17383794)
chr6 (122-178)||(18693635-18693691)
chr6 (119-171)||(29467291-29467343)
chr6 (118-178)||(30859919-30859979)
chr6 (118-178)||(31038761-31038821)
chr6 (118-178)||(31739914-31739974)
[»] chr4 (45 HSPs)
chr4 (117-237)||(51645912-51646031)
chr4 (114-237)||(11038572-11038695)
chr4 (114-178)||(36220599-36220663)
chr4 (114-237)||(36219402-36219524)
chr4 (29-116)||(52980233-52980319)
chr4 (118-176)||(756486-756544)
chr4 (119-237)||(11039672-11039788)
chr4 (119-176)||(702651-702708)
chr4 (119-176)||(770950-771007)
chr4 (119-176)||(35060454-35060511)
chr4 (117-176)||(16038273-16038332)
chr4 (118-176)||(35055332-35055390)
chr4 (119-176)||(701633-701690)
chr4 (119-176)||(769932-769989)
chr4 (117-176)||(757500-757559)
chr4 (121-176)||(16039679-16039734)
chr4 (59-116)||(11094773-11094830)
chr4 (123-205)||(50551386-50551468)
chr4 (29-118)||(39592069-39592159)
chr4 (108-178)||(52766142-52766212)
chr4 (118-178)||(36611041-36611101)
chr4 (111-178)||(41845493-41845560)
chr4 (118-178)||(19630762-19630822)
chr4 (118-178)||(25764361-25764421)
chr4 (118-178)||(31208493-31208553)
chr4 (119-178)||(34237946-34238005)
chr4 (117-172)||(40681506-40681561)
chr4 (109-171)||(2735607-2735669)
chr4 (116-178)||(20614615-20614677)
chr4 (108-178)||(31487967-31488037)
chr4 (132-178)||(52766286-52766332)
chr4 (116-178)||(55014033-55014095)
chr4 (108-178)||(56271215-56271285)
chr4 (117-178)||(9203558-9203619)
chr4 (117-178)||(9207777-9207838)
chr4 (118-178)||(11649503-11649564)
chr4 (117-178)||(32617596-32617657)
chr4 (117-178)||(42369508-42369569)
chr4 (188-237)||(51644805-51644854)
chr4 (118-178)||(1098052-1098112)
chr4 (118-178)||(17475882-17475942)
chr4 (118-178)||(25618435-25618495)
chr4 (118-178)||(27509632-27509692)
chr4 (110-158)||(39899502-39899550)
chr4 (118-178)||(41610126-41610186)
[»] chr1 (40 HSPs)
chr1 (119-237)||(46015797-46015915)
chr1 (117-237)||(33332175-33332295)
chr1 (122-237)||(33333352-33333467)
chr1 (112-237)||(46014694-46014819)
chr1 (134-237)||(2939730-2939833)
chr1 (119-176)||(51597961-51598018)
chr1 (118-176)||(16962009-16962067)
chr1 (110-176)||(50682588-50682654)
chr1 (119-176)||(51599434-51599491)
chr1 (119-176)||(16963427-16963484)
chr1 (119-227)||(2938567-2938670)
chr1 (117-178)||(7964111-7964172)
chr1 (114-178)||(6327936-6328000)
chr1 (114-178)||(6328329-6328393)
chr1 (114-178)||(34023573-34023637)
chr1 (116-172)||(36143140-36143196)
chr1 (118-178)||(46448740-46448800)
chr1 (29-65)||(52742743-52742779)
chr1 (119-178)||(7965509-7965568)
chr1 (119-178)||(10579674-10579733)
chr1 (119-178)||(11652876-11652935)
chr1 (119-178)||(24326582-24326641)
chr1 (119-170)||(39202965-39203016)
chr1 (111-178)||(44114517-44114584)
chr1 (108-178)||(37483043-37483113)
chr1 (117-178)||(3798709-3798770)
chr1 (115-172)||(6714708-6714765)
chr1 (117-178)||(7334927-7334988)
chr1 (117-178)||(31488023-31488084)
chr1 (117-178)||(37483542-37483603)
chr1 (117-178)||(38980053-38980114)
chr1 (108-169)||(48222496-48222557)
chr1 (59-116)||(52742786-52742843)
chr1 (118-178)||(3798323-3798383)
chr1 (118-178)||(14244559-14244619)
chr1 (118-178)||(17738665-17738725)
chr1 (118-178)||(24370114-24370174)
chr1 (118-178)||(45678711-45678771)
chr1 (118-178)||(48225393-48225453)
chr1 (118-178)||(50227913-50227973)
[»] chr8 (53 HSPs)
chr8 (117-237)||(9311019-9311139)
chr8 (108-236)||(9312117-9312245)
chr8 (119-237)||(14816570-14816687)
chr8 (119-237)||(14829053-14829170)
chr8 (117-176)||(39567061-39567120)
chr8 (118-176)||(39270795-39270853)
chr8 (120-176)||(45378549-45378605)
chr8 (121-176)||(44633775-44633830)
chr8 (117-156)||(14819391-14819430)
chr8 (121-176)||(39568509-39568564)
chr8 (111-173)||(44632698-44632760)
chr8 (109-178)||(29802150-29802219)
chr8 (35-116)||(7486326-7486408)
chr8 (29-116)||(41522488-41522588)
chr8 (117-178)||(4325973-4326034)
chr8 (109-178)||(5822024-5822093)
chr8 (107-172)||(43633111-43633176)
chr8 (118-178)||(5876835-5876895)
chr8 (112-172)||(12823259-12823319)
chr8 (118-178)||(21524656-21524716)
chr8 (118-178)||(45467436-45467496)
chr8 (117-176)||(10134606-10134665)
chr8 (117-172)||(29802576-29802631)
chr8 (111-178)||(31445661-31445728)
chr8 (117-176)||(36194937-36194996)
chr8 (119-170)||(45377427-45377478)
chr8 (132-178)||(162415-162461)
chr8 (112-178)||(2221965-2222031)
chr8 (112-178)||(11760914-11760980)
chr8 (117-178)||(3318037-3318098)
chr8 (117-178)||(7116470-7116531)
chr8 (117-178)||(9807279-9807340)
chr8 (117-178)||(11713198-11713259)
chr8 (117-178)||(12849962-12850023)
chr8 (119-172)||(13463153-13463206)
chr8 (109-178)||(18476071-18476140)
chr8 (117-178)||(33098969-33099030)
chr8 (118-178)||(41836492-41836553)
chr8 (114-178)||(162662-162726)
chr8 (118-178)||(2221593-2221653)
chr8 (108-172)||(7041957-7042021)
chr8 (118-178)||(10398697-10398757)
chr8 (118-178)||(11901494-11901554)
chr8 (118-178)||(14054787-14054847)
chr8 (118-178)||(22013461-22013521)
chr8 (118-178)||(26060105-26060165)
chr8 (112-176)||(31933581-31933645)
chr8 (118-178)||(31988513-31988573)
chr8 (118-178)||(41155013-41155073)
chr8 (117-169)||(41387560-41387612)
chr8 (118-178)||(45123219-45123279)
chr8 (110-170)||(45466300-45466360)
chr8 (118-178)||(45467808-45467868)
[»] chr2 (38 HSPs)
chr2 (117-226)||(7184879-7184989)
chr2 (118-176)||(36889748-36889806)
chr2 (118-178)||(36888337-36888397)
chr2 (120-237)||(13809426-13809542)
chr2 (111-236)||(13810521-13810644)
chr2 (117-209)||(35738361-35738453)
chr2 (117-178)||(7031803-7031864)
chr2 (109-178)||(7032155-7032224)
chr2 (117-178)||(27516157-27516218)
chr2 (29-65)||(7983472-7983508)
chr2 (118-178)||(26892463-26892523)
chr2 (118-178)||(26897902-26897962)
chr2 (114-178)||(32194828-32194892)
chr2 (117-176)||(34166841-34166901)
chr2 (111-178)||(15130053-15130120)
chr2 (119-178)||(31557091-31557150)
chr2 (119-178)||(34618521-34618580)
chr2 (111-178)||(35251488-35251555)
chr2 (117-172)||(38578187-38578242)
chr2 (118-172)||(19297526-19297580)
chr2 (132-178)||(30785836-30785882)
chr2 (132-178)||(31309646-31309692)
chr2 (119-172)||(3603504-3603557)
chr2 (117-178)||(4602816-4602877)
chr2 (70-111)||(7983526-7983567)
chr2 (113-178)||(11131183-11131248)
chr2 (118-171)||(15044738-15044791)
chr2 (117-178)||(18904597-18904658)
chr2 (117-178)||(27516540-27516601)
chr2 (115-172)||(28190493-28190550)
chr2 (113-178)||(28958114-28958179)
chr2 (117-178)||(31309766-31309827)
chr2 (117-178)||(36099291-36099352)
chr2 (118-178)||(3124327-3124387)
chr2 (118-178)||(7182698-7182758)
chr2 (114-178)||(30786025-30786089)
chr2 (114-178)||(35589165-35589229)
chr2 (111-171)||(45001045-45001105)
[»] chr5 (32 HSPs)
chr5 (117-237)||(19718830-19718950)
chr5 (117-178)||(4959559-4959620)
chr5 (117-178)||(11079629-11079690)
chr5 (109-178)||(19798719-19798788)
chr5 (117-178)||(22803589-22803650)
chr5 (117-178)||(37812229-37812290)
chr5 (117-178)||(42026663-42026724)
chr5 (118-178)||(1155963-1156023)
chr5 (29-65)||(7426954-7426990)
chr5 (118-178)||(30112709-30112769)
chr5 (114-178)||(42026278-42026342)
chr5 (119-178)||(4349495-4349554)
chr5 (119-178)||(4349874-4349933)
chr5 (119-178)||(6172340-6172399)
chr5 (119-178)||(9040743-9040802)
chr5 (119-178)||(9438237-9438296)
chr5 (115-178)||(11079124-11079187)
chr5 (119-178)||(24100267-24100326)
chr5 (119-178)||(31369926-31369985)
chr5 (119-178)||(42382172-42382231)
chr5 (70-116)||(7426890-7426936)
chr5 (114-172)||(8127467-8127525)
chr5 (116-178)||(16670027-16670089)
chr5 (116-178)||(43476437-43476499)
chr5 (117-178)||(435552-435613)
chr5 (117-178)||(6157496-6157557)
chr5 (117-178)||(16791969-16792030)
chr5 (117-178)||(21289529-21289590)
chr5 (118-171)||(25333194-25333247)
chr5 (121-178)||(37812550-37812607)
chr5 (118-178)||(17339794-17339854)
chr5 (118-178)||(24100699-24100759)
[»] scaffold0194 (2 HSPs)
scaffold0194 (118-178)||(19244-19304)
scaffold0194 (121-178)||(18070-18127)
[»] scaffold0031 (3 HSPs)
scaffold0031 (108-176)||(129420-129488)
scaffold0031 (117-176)||(123422-123481)
scaffold0031 (117-176)||(134298-134357)
[»] scaffold0025 (1 HSPs)
scaffold0025 (59-116)||(56508-56565)
[»] scaffold0295 (1 HSPs)
scaffold0295 (118-178)||(8215-8275)
[»] scaffold0006 (1 HSPs)
scaffold0006 (118-178)||(83385-83445)
[»] scaffold0005 (1 HSPs)
scaffold0005 (114-178)||(1470-1534)
[»] scaffold0352 (1 HSPs)
scaffold0352 (112-178)||(11423-11489)
[»] scaffold0220 (1 HSPs)
scaffold0220 (119-176)||(25963-26020)
[»] scaffold0135 (6 HSPs)
scaffold0135 (117-178)||(5856-5917)
scaffold0135 (117-178)||(10071-10132)
scaffold0135 (117-178)||(14286-14347)
scaffold0135 (117-178)||(18501-18562)
scaffold0135 (117-178)||(22716-22777)
scaffold0135 (117-178)||(26931-26992)
[»] scaffold0054 (2 HSPs)
scaffold0054 (117-178)||(57020-57081)
scaffold0054 (118-178)||(57557-57617)
[»] scaffold0026 (1 HSPs)
scaffold0026 (117-178)||(99979-100040)
[»] scaffold0017 (1 HSPs)
scaffold0017 (121-178)||(172910-172967)
[»] scaffold0014 (1 HSPs)
scaffold0014 (118-178)||(230871-230931)
[»] scaffold0012 (1 HSPs)
scaffold0012 (118-178)||(144717-144777)
[»] scaffold0009 (1 HSPs)
scaffold0009 (114-178)||(242160-242224)
[»] scaffold0002 (1 HSPs)
scaffold0002 (114-162)||(429163-429211)

Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 37)
Name: chr7

Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 14108829 - 14108940
7 ggaacagagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14108829 ggaacaaagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 14108928  T
107 caataaaatata 118  Q
14108929 caataaaatata 14108940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 14418786 - 14418897
7 ggaacagagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14418786 ggaacaaagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 14418885  T
107 caataaaatata 118  Q
14418886 caataaaatata 14418897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 45087067 - 45087183
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttac 220  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
45087067 cttaattgttattttagtcctttaactaattttttggtatcggtttggtcccataactaaaaaaaggtccgttttggtattttaacttttgctccgttac 45087166  T
221 atgttttagtcctttcc 237  Q
    ||||||| ||| |||||    
45087167 atgttttggtcttttcc 45087183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 45088310 - 45088192
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||       ||||||||||||||||||||||||||||| |||    
45088310 ggcttaattgctattttagtcccttaactaattgtttggtatcagtttggtcccataactaaaaaaaggtccgttttggtattttaacttttgctcagtt 45088211  T
219 acatgttttagtcctttcc 237  Q
    || |||||| |||||||||    
45088210 acttgttttggtcctttcc 45088192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 116 - 237
Target Start/End: Original strand, 45596866 - 45596988
116 ataggcttaattgctattttagtcccttaactaa-ttttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctc 214  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||||| |  |||||||        ||||||||||||||||||| |||  |||    
45596866 ataggcttaattgctattttaatcccttaactaatttttttggtatcggtttgataacataactaaaaaaaagtccgttttggtattttaagtttatctc 45596965  T
215 cgttacatgttttagtcctttcc 237  Q
    | ||||||||||| |||||||||    
45596966 cattacatgttttggtcctttcc 45596988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 21709149 - 21709215
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||    
21709149 taaaatttaggcttaattgctattttcgtcccttaactaattttttagtatcgctttggtcccataa 21709215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 40930740 - 40930653
29 ttttaggaatgattatgttgatgaagat-taagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||||||||||||||||||||||||   ||||||| |||||||||||||||||||||| | ||||||||| ||||| |||||||||    
40930740 ttttaggaatgattatgttgatgaagataggagaagaagatgaagaaaggtgagaaaaata-taagtgttggtggtttataataaaata 40930653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 26024888 - 26024944
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||| || ||||||||||| |||||||||||||| |||||||||||||    
26024888 gcttaattgctatcttcgtcccttaacttattttttggtatcgctttggtcccataa 26024944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 21710661 - 21710602
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| ||||| |||||| ||||||||||| |||||||||||||| |||||||||||||    
21710661 taggctgaattgatatttttgtcccttaacttattttttggtatcgctttggtcccataa 21710602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 38406350 - 38406266
29 ttttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||| |||||||  |||||||| |||||||   |||||||||||||| ||||||||| |||| | | |||||||||||||||    
38406350 ttttaggaataattatgtccatgaagatgaagaaga---tgaagaaaggtgaggaaaatatttggtgtggatggtttacaataaaata 38406266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 4167825 - 4167785
29 ttttaggaatgattatgttgatgaagattaagaagaaaatg 69  Q
    |||||||||||||||||||||||||||| ||||||||||||    
4167825 ttttaggaatgattatgttgatgaagatgaagaagaaaatg 4167785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 19070015 - 19069951
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||| ||  ||||||||| |||||    
19070015 atataggcttaattacttttttggtcccttaacttattttttggtttcattttggtcccttaact 19069951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36701357 - 36701417
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
36701357 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 36701417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 40852227 - 40852159
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
40852227 taaaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 40852159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 23350915 - 23350974
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||  ||||||||||||||| |||||||||| ||| ||||||||| |||||    
23350915 ggcttaattactcatttagtcccttaacttattttttggtttcgttttggtcccttaact 23350974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 24733625 - 24733688
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24733625 tataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24733688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 116
Target Start/End: Complemental strand, 4167746 - 4167700
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||  |||| ||| |||||||||||||||    
4167746 aagaaaggtgagaaaaatattaggtgtcggtggtttacaataaaata 4167700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 172
Target Start/End: Original strand, 19543481 - 19543543
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||  ||||||||||||||| |||||||||||| || ||| |||||| |||| ||||    
19543481 taaaatataaacttaattgctattttcgtcccttaactatttatttagtatcgctttgatccc 19543543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 39143572 - 39143510
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
39143572 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 39143510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 48095423 - 48095361
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
48095423 ataggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 48095361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3217814 - 3217753
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3217814 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3217753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 7777017 - 7776956
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7777017 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 7776956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 8736184 - 8736123
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
8736184 taggcttaattactcttttggtcccttaatttattttttggtgtcgttttggtcccttaact 8736123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 10986695 - 10986752
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| || |||| |||||||||||| ||||||||||||| |||| ||| ||||    
10986695 ggcttaatttctcttttcgtcccttaactatttttttggtatcgttttgctcctataa 10986752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 13965038 - 13965099
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
13965038 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 13965099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 160
Target Start/End: Complemental strand, 26025924 - 26025883
119 ggcttaattgctattttagtcccttaactaattttttggtat 160  Q
    ||||||||||||||||| |||| ||||||||||| |||||||    
26025924 ggcttaattgctatttttgtcctttaactaatttcttggtat 26025883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 27284240 - 27284301
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
27284240 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 27284301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 39383805 - 39383858
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
39383805 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 39383858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 40738193 - 40738246
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||||| |||||| ||||||||  || |||||| |||||||||    
40738193 ggcttaattgctattttcgtccctcaactaattaattagtatcgctttggtccc 40738246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 45057539 - 45057600
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
45057539 taggcttaattactcttttggtcccttaacttattttttggtttcgttttgatcccttaact 45057600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 47987325 - 47987386
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
47987325 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 47987386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 19105666 - 19105598
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||||||||||||| || |||| ||||||||||| |||||||| | ||  ||||||||| |||||    
19105666 taaattataggcttaattactcttttggtcccttaacttattttttgatttcattttggtcccttaact 19105598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 20493744 - 20493804
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
20493744 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 20493804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31852141 - 31852081
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31852141 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31852081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 36701799 - 36701739
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
36701799 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 36701739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 37374516 - 37374456
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37374516 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37374456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45456733 - 45456793
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45456733 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45456793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: scaffold0029

Target: scaffold0029; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 71887 - 71769
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||       |||||||| ||||||||||||||||||||||||    
71887 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccataactaaaaaaaggtccgttgtggtattttaacttttgctccgtt 71788  T
219 acatgttttagtcctttcc 237  Q
    ||||||||| |||||||||    
71787 acatgttttggtcctttcc 71769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 118 - 237
Target Start/End: Original strand, 70668 - 70788
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact-nnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||| ||||||||||||||||||| |||||    
70668 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactaaaaaaaaagtccattttggtattttaacttttactccg 70767  T
217 ttacatgttttagtcctttcc 237  Q
    ||||||||||| |||||||||    
70768 ttacatgttttggtcctttcc 70788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0394 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0394

Target: scaffold0394; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 117 - 232
Target Start/End: Original strand, 14268 - 14384
117 taggcttaattgctattttagtcccttaactaa-ttttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||    
14268 taggcttaattgctattttagtcccttaactaatttttttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttcc 14367  T
216 gttacatgttttagtcc 232  Q
14368 gttacatgttttagtcc 14384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 31)
Name: chr3

Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 116 - 232
Target Start/End: Original strand, 27688483 - 27688599
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||    
27688483 ataggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttcc 27688582  T
216 gttacatgttttagtcc 232  Q
    |||||||||||| ||||    
27688583 gttacatgttttggtcc 27688599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 117 - 232
Target Start/End: Complemental strand, 27695635 - 27695520
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| ||||    
27695635 taggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactgaaaaaaagtccgttttggtattttaacttttgttccg 27695536  T
217 ttacatgttttagtcc 232  Q
    ||||||||||| ||||    
27695535 ttacatgttttggtcc 27695520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 20184446 - 20184538
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttt 209  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
20184446 taggcttaattgttattttagtcccttaactaattttttggtatcggtttggtcccataactaaaaataaatccgttttggtattttaacttt 20184538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 118 - 232
Target Start/End: Complemental strand, 20185872 - 20185758
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgt 217  Q
    ||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||||||||        ||  ||||||||||||||||||||| |||||    
20185872 aggcttaattgctattttagtccattacctaatttttttgtatcggtttgatcccataactaaaaaaaagtttgttttggtattttaacttttgttccgt 20185773  T
218 tacatgttttagtcc 232  Q
    |||||||||| ||||    
20185772 tacatgttttggtcc 20185758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 121 - 235
Target Start/End: Original strand, 39991507 - 39991620
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttac 220  Q
    |||||||| ||||||||| ||||||||||||||||| ||||| |||| ||||||||||         |||||||||||||||||||||||||||| | ||    
39991507 cttaattgttattttagttccttaactaattttttgatatcgttttgatcccataactaaaaaaaa-tccgttttggtattttaacttttgctccatcac 39991605  T
221 atgttttagtccttt 235  Q
39991606 atgttttagtccttt 39991620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 39992561 - 39992495
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||  ||| |||||||||    
39992561 taaaatataggcttaattactattttagtcccttaactaattttttggtatcacttttgtcccataa 39992495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21815897 - 21815965
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| |||| |||||||||||||||| ||||||||||||||||||| |||||| |||||| ||||||    
21815897 aataaattataagcttaattgctattttcgtcccttaactaattttttagtatcgctttggttccataa 21815965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 49221505 - 49221566
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||||||| |||||| ||||||||||||||||||||||||||| || |||||||||||    
49221505 taggtttaattgttatttttgtcccttaactaattttttggtatcgggttagtcccataact 49221566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 21817457 - 21817401
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||| |||||||  ||||||||||||||||||||||||| |||||||||||||    
21817457 gcttaattactattttcatcccttaactaattttttggtatcgctttggtcccataa 21817401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 45940746 - 45940679
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45940746 aaaatttaggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 45940679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 12061622 - 12061683
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
12061622 taggcttaattactcttttggtcccttaacttattttttggtgtcgttttggtcccttaact 12061683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 18024977 - 18024916
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||| ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18024977 taggcttaattactaatttggtcccttaacttattttttggtttcgttttggtcccttaact 18024916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 12739959 - 12740023
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
12739959 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 12740023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 172
Target Start/End: Original strand, 32304229 - 32304285
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
32304229 ataggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 32304285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 109 - 172
Target Start/End: Original strand, 13355165 - 13355228
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||| |||||||||| || | ||||||||||||||||| ||  ||||||||| |||||||||    
13355165 ataaaaaataggcttaaatgttcttttagtcccttaactatttaattggtatcgctttggtccc 13355228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 14859193 - 14859134
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||||  |||||||| || |||||| |||||| |||||| ||||||    
14859193 taggcttaattgctattttcttcccttaaatatttttttagtatcgctttggttccataa 14859134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 22976973 - 22977032
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    ||||||||||||||||| || |||| |||| |||||| |||||||||| ||| |||||||    
22976973 aaaatataggcttaattacttttttggtcctttaacttattttttggtttcgttttggtc 22977032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 38771676 - 38771617
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
38771676 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 38771617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 40503790 - 40503731
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
40503790 ggcttaattgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 40503731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Complemental strand, 17934151 - 17934081
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||  ||||||||| ||  ||||||||||||||| |||||||||| | | ||||||||| |||||    
17934151 aataaaataatggcttaattactcatttagtcccttaacttattttttggttttgttttggtcccttaact 17934081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 171
Target Start/End: Original strand, 966975 - 967032
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||    
966975 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcc 967032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 237
Target Start/End: Complemental strand, 5348881 - 5348837
192 ttttggtattttaacttttgctccgttacatgttttagtcctttcc 237  Q
    ||||||||||||||||||| ||||||||||| |||| |||||||||    
5348881 ttttggtattttaactttt-ctccgttacatattttggtcctttcc 5348837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 13302018 - 13301961
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||    
13302018 tataggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtccc 13301961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 13312674 - 13312617
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||    
13312674 tataggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtccc 13312617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 19794837 - 19794780
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||  || |||| ||||||||||| |||||||||| ||| |||||||||    
19794837 tataggcttaataactcttttggtcccttaacttattttttggtttcgttttggtccc 19794780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 24243057 - 24242996
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24243057 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24242996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 28004264 - 28004325
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
28004264 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 28004325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 43464812 - 43464869
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
43464812 ggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtcccataa 43464869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 51891360 - 51891299
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
51891360 taggtttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 51891299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 178
Target Start/End: Complemental strand, 8327806 - 8327766
138 tcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||||||||||||||||||| |||||    
8327806 tcccttaactatttatttggtatcggtttggtcccttaact 8327766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 31049133 - 31049077
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
31049133 ttaaatgcttttttagtcccttaactatttaattggtatcgctttggtcccttaact 31049077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 35)
Name: chr6

Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 118 - 232
Target Start/End: Complemental strand, 29751199 - 29751085
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgt 217  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||||    
29751199 aggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgt 29751100  T
218 tacatgttttagtcc 232  Q
    |||||||||| ||||    
29751099 tacatgttttggtcc 29751085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 119 - 232
Target Start/End: Original strand, 29744781 - 29744894
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| ||||||    
29744781 ggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgtt 29744880  T
219 acatgttttagtcc 232  Q
    ||||||||| ||||    
29744881 acatgttttggtcc 29744894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 117 - 227
Target Start/End: Original strand, 14403686 - 14403796
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| ||||||| ||||||||  |||||||||||||||       ||||| ||||||||||||||||||||| |||    
14403686 taggcttaattgctattttagtcccttacctaatttgttggtatcactttggtcccataactaaaatttggtccattttggtattttaacttttgcgccg 14403785  T
217 ttacatgtttt 227  Q
14403786 ttacatgtttt 14403796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 21611913 - 21611972
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
21611913 taggcttaattgctattttcgtcccttaactaattttttggtatcgatttggtcccataa 21611972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 29 - 114
Target Start/End: Original strand, 33801796 - 33801882
29 ttttaggaatgattatgttgatgaagatta-agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaa 114  Q
    ||||||||||||||||||||||||||||   ||||||| |||||||||||||| ||||||||  ||||||||| ||||| |||||||    
33801796 ttttaggaatgattatgttgatgaagataggagaagaagatgaagaaaggtgaaaaaaatatcaagtgttggtggtttataataaaa 33801882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 21282816 - 21282874
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| ||||||||| ||||||||| |||||| |||||||||||||    
21282816 aggcttaattgctattttcgtcccttaattaatttttttgtatcgctttggtcccataa 21282874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 5660249 - 5660192
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||| ||||||||||||||||||| ||||||| |||||    
5660249 ggcttaattgctattttcgtccctaaactaattttttggtatcgttttggtctcataa 5660192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 5659106 - 5659162
121 cttaattgctatttta-gtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||  |||||||||||||||||||||||||  |||||||||||||    
5659106 cttaattgctatttttcgtcccttaactaattttttggtatcactttggtcccataa 5659162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 158
Target Start/End: Complemental strand, 21283965 - 21283922
115 tataggcttaattgctattttagtcccttaactaattttttggt 158  Q
    |||||||||||||| |||||| ||||||||||||||||||||||    
21283965 tataggcttaattgttattttcgtcccttaactaattttttggt 21283922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 21612933 - 21612882
125 attgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||| |||||| ||||||||| |||||||||||||||| |||||||||||||    
21612933 attgttattttcgtcccttaattaattttttggtatcgttttggtcccataa 21612882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 8938883 - 8938945
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
8938883 ataggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 8938945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 19048233 - 19048303
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||||||||| || |||| ||||||||||| |||||||||| ||  ||||||||| |||||    
19048233 aataaaataaaggcttaattacttttttggtcccttaacttattttttggtttcattttggtcccttaact 19048303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 8286754 - 8286689
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||| || |||| | ||||||||| |||||||||| ||| ||||||||| |||||    
8286754 aatataggcttaattacttttttgggcccttaacttattttttggtttcgttttggtcccttaact 8286689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 3618781 - 3618840
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
3618781 ggcttaaatgcttttttagtcccttaactatttaattggtatcgctttggtcccttaact 3618840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 5645932 - 5645865
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
5645932 aaaataaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 5645865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 8286307 - 8286370
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| || |||| ||| ||||||| |||||||||| ||| ||||||||| |||||    
8286307 tataggcttaattactcttttggtctcttaacttattttttggtttcgttttggtcccttaact 8286370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 12260444 - 12260499
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
12260444 taggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 12260499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 18700401 - 18700460
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18700401 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 18700460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 26841664 - 26841605
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
26841664 ggcttaattactctttttgtcccttaacttattttttggtttcgttttggtcccttaact 26841605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 5645546 - 5645599
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
5645546 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 5645599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 6888781 - 6888842
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
6888781 taggcttaattactcttttggtcccttaatttattttttggtttcgttttggtcccttaact 6888842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 21272183 - 21272118
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| ||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
21272183 aatattggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 21272118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 26392905 - 26392844
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
26392905 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 26392844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 151
Target Start/End: Original strand, 29465754 - 29465787
118 aggcttaattgctattttagtcccttaactaatt 151  Q
    |||||||||||||||||| |||||||||||||||    
29465754 aggcttaattgctattttcgtcccttaactaatt 29465787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 31038321 - 31038374
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
31038321 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 31038374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Original strand, 32223834 - 32223903
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| ||| |||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
32223834 ataaaataaaggtttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 32223903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 3366493 - 3366557
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| ||||||||| ||| ||||| || ||  ||||||||| ||||||||| |||||    
3366493 atataggcttaaatgctattttggtctcttaattatttaattggtatcgctttggtcccttaact 3366557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 12261553 - 12261489
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||  |||| |||||||||||| || |||||||||  ||||||||| |||||    
12261553 atataggcttaaatgcgtttttggtcccttaactatttatttggtatcactttggtcccttaact 12261489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 13703376 - 13703440
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| |||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
13703376 atataagcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 13703440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 17383734 - 17383794
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17383734 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 17383794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 18693691 - 18693635
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18693691 ttaattacttttttggtcccttaacttattttttggtttcgttttggtcccttaact 18693635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 171
Target Start/End: Complemental strand, 29467343 - 29467291
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||||||||||||||| |||||||||||| || ||| |||| | ||||||||    
29467343 ggcttaattgctattttcgtcccttaactatttatttagtattgctttggtcc 29467291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 30859919 - 30859979
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
30859919 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 30859979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31038821 - 31038761
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||||||||||||||| | |||||||| ||| |||||| || |||||    
31038821 aggcttaattactcttttagtcccttaacttaatttttggtttcgttttggttccttaact 31038761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31739974 - 31739914
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31739974 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31739914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 45)
Name: chr4

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 117 - 237
Target Start/End: Complemental strand, 51646031 - 51645912
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||        ||||||||||||||||||| |||  |||||    
51646031 taggcttaattgctattttagtcccttagctaattttttggtatcggtttggtcccataactaaaaaaa-gtccgttttggtattttaagtttatctccg 51645933  T
217 ttacatgttttagtcctttcc 237  Q
    ||||||||||| |||||||||    
51645932 ttacatgttttggtcctttcc 51645912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 11038572 - 11038695
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgct 213  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||        ||| ||||||||||||||||||||| |    
11038572 atattggcttaattgctattttagtcccttagctaattttttggtattgctttggtcccataactaaaaaaaagtctgttttggtattttaacttttgtt 11038671  T
214 ccgttacatgttttagtcctttcc 237  Q
    | ||| | |||||| |||||||||    
11038672 ctgtttcttgttttggtcctttcc 11038695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 36220663 - 36220599
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
36220663 atataggcttaattgctattttagtaccttaactaattttttggtatcgttttggtcccataact 36220599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 36219402 - 36219524
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgct 213  Q
    ||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||        ||||||||| ||||||||| |||  ||    
36219402 atatatgcttaattgctattttagtcccttaactaatttttgagtatcggtttggtcccataactaaaaaaa-gtccgttttagtattttaagtttatct 36219500  T
214 ccgttacatgttttagtcctttcc 237  Q
    ||||||||| |||| ||| |||||    
36219501 ccgttacatattttggtcatttcc 36219524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 52980319 - 52980233
29 ttttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||||||||| || ||||| |  |||||||||||||||||||||  |||||||| |||||||||||||||    
52980319 ttttaggaatgattatgttgatgaagatgaaaaagaataa-aagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 52980233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 756486 - 756544
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
756486 aggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 756544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 11039788 - 11039672
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||  ||||||||||||||||||||  |||| ||  ||||||        |||| ||||||||||||||||||||||||||     
11039788 ggcttaattgctattttagtcatttaactaattttttggtatcactttgatc--ataactaaaaaaaagtccattttggtattttaacttttgctccgtc 11039691  T
219 acatgttttagtcctttcc 237  Q
    ||||||||||||| |||||    
11039690 acatgttttagtcatttcc 11039672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 702708 - 702651
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
702708 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 702651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 771007 - 770950
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
771007 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 770950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 35060511 - 35060454
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
35060511 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 35060454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 16038273 - 16038332
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
16038273 taggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 16038332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 35055332 - 35055390
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
35055332 aggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 35055390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 701633 - 701690
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
701633 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 701690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 769932 - 769989
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
769932 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 769989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 757559 - 757500
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||||  |||||||||| |||||||||||||| |||||||||||||    
757559 taggcttaattgctattttcatcccttaacttattttttggtatcgctttggtcccataa 757500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 16039734 - 16039679
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| |||||||||||||||||||||||||| || ||||||||||    
16039734 cttaattgctatttttgtcccttaactaattttttggtatcgtttcggtcccataa 16039679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 59 - 116
Target Start/End: Complemental strand, 11094830 - 11094773
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  |||||||| |||||||||||||||    
11094830 agaagaagatgaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 11094773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 123 - 205
Target Start/End: Complemental strand, 50551468 - 50551386
123 taattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaa 205  Q
    |||||| |||||||||||||||| |||||||||||||||||||| || ||||||||        |||||||||||||||||||    
50551468 taattgttattttagtcccttaattaattttttggtatcggtttagttccataactaaaaaaaagtccgttttggtattttaa 50551386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 118
Target Start/End: Original strand, 39592069 - 39592159
29 ttttaggaatgattatgttgatgaagattaagaagaaa-atgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaatata 118  Q
    |||||||||||||||||  ||||||||  || | | || | ||||||||||||||||||||||  |||||||| |||||||||||||||||    
39592069 ttttaggaatgattatgaagatgaagaagaatagggaagaagaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaatata 39592159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 52766142 - 52766212
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
52766142 aataaaatataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 52766212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36611041 - 36611101
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||||||||||||||| |||||||||| ||| ||||||||| |||||    
36611041 aggcttaattactcttttagtcccttaacttattttttggtttcgttttggtcccttaact 36611101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 41845493 - 41845560
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||||||  ||||||||| ||||||||| |||||    
41845493 aaaaaataggcttaaatgctcttttggtcccttaactaattaattggtatcgctttggtcccttaact 41845560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 19630762 - 19630822
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
19630762 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 19630822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 25764361 - 25764421
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
25764361 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 25764421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31208553 - 31208493
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
31208553 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 31208493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 34238005 - 34237946
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
34238005 ggcttaaatgctattttggtcccttaactatttaattggtatcgttttggtcccttaact 34237946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 40681561 - 40681506
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
40681561 taggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 40681506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 2735669 - 2735607
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||| ||||||||||| |||| |||| ||||||||| || || |||||||||| ||||||||    
2735669 ataaattataggcttaaatgctcttttggtcccttaaatatttatttggtatcgctttggtcc 2735607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 20614677 - 20614615
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
20614677 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 20614615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 31487967 - 31488037
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| | ||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31487967 aataaaatttgggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31488037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 52766286 - 52766332
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
52766286 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 52766332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 55014095 - 55014033
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || ||||||||| |||||| |||||||||| ||| |||||| || |||||    
55014095 ataggcttaattactcttttagtccattaacttattttttggtttcgttttggtaccttaact 55014033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Complemental strand, 56271285 - 56271215
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||| ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
56271285 aatataatctaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 56271215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9203619 - 9203558
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
9203619 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 9203558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9207838 - 9207777
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
9207838 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 9207777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 11649503 - 11649564
118 aggcttaattgctattttagtcccttaactaattt-tttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||||||||||||||||||||  ||||||||| ||||| ||| |||||    
11649503 aggcttaaatgctcttttagtcccttaactaatttaattggtatcgctttggacccttaact 11649564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 32617657 - 32617596
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
32617657 taggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 32617596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 42369569 - 42369508
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
42369569 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 42369508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 51644805 - 51644854
188 tccgttttggtattttaacttttgctccgttacatgttttagtcctttcc 237  Q
    |||||||||||||||||| |||  || ||||||||||||| |||||||||    
51644805 tccgttttggtattttaagtttatcttcgttacatgttttggtcctttcc 51644854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 1098052 - 1098112
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
1098052 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 1098112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 17475942 - 17475882
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17475942 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 17475882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 25618435 - 25618495
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
25618435 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 25618495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 27509632 - 27509692
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
27509632 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 27509692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 158
Target Start/End: Complemental strand, 39899550 - 39899502
110 taaaatataggcttaattgctattttagtcccttaactaattttttggt 158  Q
    ||||| |||||||||||| || |||| ||||||||||| ||||||||||    
39899550 taaaaaataggcttaattactcttttggtcccttaacttattttttggt 39899502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 41610126 - 41610186
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
41610126 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 41610186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 40)
Name: chr1

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 46015915 - 46015797
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||        ||||||||||||||||||||||||| ||||||    
46015915 ggcttaattgttattttagtcccttaagtaattttttggtatcgctttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgtt 46015816  T
219 acatgttttagtcctttcc 237  Q
     | ||||||||||||||||    
46015815 tcttgttttagtcctttcc 46015797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 117 - 237
Target Start/End: Original strand, 33332175 - 33332295
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    ||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||        |||||||||| |||||||||||||||||||    
33332175 taggcttaattgctattttagtctcttaactagttgtttggtatcggtttggtcccataactaaaaaaatgtccgttttgatattttaacttttgctccg 33332274  T
217 ttacatgttttagtcctttcc 237  Q
    |||| |||||| ||| |||||    
33332275 ttacttgttttggtcatttcc 33332295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 33333467 - 33333352
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttaca 221  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |        ||||||||||||||||||| |||||||||||||||    
33333467 ttaattgctattttagtcccttaactaattttttggtatcagtttggtcccataattaaaaaaatgtccgttttggtattttaatttttgctccgttaca 33333368  T
222 tgttttagtcctttcc 237  Q
    | |||| ||| |||||    
33333367 tcttttggtcatttcc 33333352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 112 - 237
Target Start/End: Original strand, 46014694 - 46014819
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttg 211  Q
    |||| |||||||||||||||||||||||  ||||||||||||||||||||| || | ||||||||||        ||| |||||||||||||||||||||    
46014694 aaatgtaggcttaattgctattttagtcatttaactaattttttggtatcgcttcgatcccataactaaaaaaaagtctgttttggtattttaacttttg 46014793  T
212 ctccgttacatgttttagtcctttcc 237  Q
    ||| || |||||||||||||||||||    
46014794 ctctgtcacatgttttagtcctttcc 46014819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 237
Target Start/End: Complemental strand, 2939833 - 2939730
134 ttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttacatgttttagtcct 233  Q
    ||||||||||||||||| |||||||||||||||||||| ||||||        ||| |||||||||||||||||||||||||||||| |||||| ||| |    
2939833 ttagtcccttaactaatattttggtatcggtttggtcctataactaaaaaaatgtctgttttggtattttaacttttgctccgttacttgttttggtcat 2939734  T
234 ttcc 237  Q
2939733 ttcc 2939730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 51597961 - 51598018
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
51597961 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 51598018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 16962009 - 16962067
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||| | |||||||| ||||    
16962009 aggcttaattgctatttttgtcccttaactaattttttggtattgctttggtcctataa 16962067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 50682654 - 50682588
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||| ||| |||||||||||||||| ||||||||| || ||||||||||||| |||||||||||||    
50682654 taaaaaataagcttaattgctattttggtcccttaattatttttttggtatcgctttggtcccataa 50682588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 51599491 - 51599434
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||| ||| ||||    
51599491 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttgatcctataa 51599434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 16963484 - 16963427
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||| |||||| || ||||||||||||||||||||||| ||||||| |||||    
16963484 ggcttaattgttattttcgttccttaactaattttttggtatcgatttggtctcataa 16963427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 119 - 227
Target Start/End: Original strand, 2938567 - 2938670
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||| |||||||||||||| ||||||||||| ||||||  ||||||||       |||||| |||  |||||||| ||||||||||||    
2938567 ggcttaattgctattt-agtcccttaactaa-tttttggtatcagtttgg--ccataactaaaaaaaggtccg-tttaatattttaatttttgctccgtt 2938661  T
219 acatgtttt 227  Q
2938662 acatgtttt 2938670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7964111 - 7964172
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
7964111 taggcttaaatgctcttttggtcccttaactatttatttggtatcgctttggtcccttaact 7964172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 6327936 - 6328000
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||  |||||||||||| ||  ||||||||| ||||||||| |||||    
6327936 atataggcttaattgctctttaggtcccttaactatttaattggtatcgctttggtcccttaact 6328000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 6328393 - 6328329
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||| ||||||||| || ||  ||||||||| ||||||||| |||||    
6328393 atataggcttaattgctcttttggtcccttaagtatttaattggtatcgctttggtcccttaact 6328329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 34023637 - 34023573
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
34023637 atataggtttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 34023573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 36143196 - 36143140
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
36143196 ataggcttaattgctcttttcgtcccttaagttattatttggtatcgatttggtccc 36143140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 46448800 - 46448740
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
46448800 aggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 46448740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 52742743 - 52742779
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
52742743 ttttaggaatgattatgttgatgaagatgaagaagaa 52742779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 7965568 - 7965509
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
7965568 ggcttaaatgctcttttggtcccttaactatttatttggtatcgttttggtcccttaact 7965509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 10579733 - 10579674
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
10579733 ggcttaattactcttttggtcccttaacttattttttggtttcgatttggtcccttaact 10579674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 11652876 - 11652935
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
11652876 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 11652935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 24326582 - 24326641
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
24326582 ggcttaaatgctcttttggtcccttaactatttatttggtatcgctttggtcccttaact 24326641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 39203016 - 39202965
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    |||||||||| ||||||||||| |||| |||||| ||||||||| |||||||    
39203016 ggcttaattgttattttagtcctttaattaatttgttggtatcgatttggtc 39202965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 44114584 - 44114517
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
44114584 aaaaaataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 44114517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 37483043 - 37483113
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| | |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37483043 aataaaaaaaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37483113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3798770 - 3798709
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3798770 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3798709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 6714765 - 6714708
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||||    
6714765 tataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtccc 6714708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 7334988 - 7334927
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7334988 taggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 7334927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 31488023 - 31488084
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31488023 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31488084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 37483603 - 37483542
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37483603 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37483542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 38980114 - 38980053
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
38980114 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 38980053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 48222557 - 48222496
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggt 169  Q
    ||||||||||||||| || |||| |||| ||||||||||||  ||||| ||||||| |||||    
48222557 aataaaatataggctaaagtgctcttttggtcccttaactatatttttagtatcggattggt 48222496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 116
Target Start/End: Original strand, 52742786 - 52742843
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  ||||  || ||||||| |||||||    
52742786 agaagaagatgaagaaaggtgagaaaaatattaggtgtcagtggtttacagtaaaata 52742843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 3798323 - 3798383
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3798323 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3798383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 14244619 - 14244559
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
14244619 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 14244559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 17738725 - 17738665
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
17738725 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 17738665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 24370114 - 24370174
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24370114 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24370174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45678711 - 45678771
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45678711 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45678771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 48225453 - 48225393
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
48225453 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 48225393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 50227973 - 50227913
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
50227973 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 50227913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 53)
Name: chr8

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 117 - 237
Target Start/End: Original strand, 9311019 - 9311139
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||        ||| ||||||||||||||||||||| ||||    
9311019 taggcttaattgctattttagtcccttatctaattttttggtatcgctttggtcccataactaaaaaaaagtctgttttggtattttaacttttgttccg 9311118  T
217 ttacatgttttagtcctttcc 237  Q
    || | |||||| |||||||||    
9311119 tttcttgttttggtcctttcc 9311139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 108 - 236
Target Start/End: Complemental strand, 9312245 - 9312117
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaact 207  Q
    |||||||  |||| ||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||        ||||||||||||||||||| |    
9312245 aataaaaagtaggtttaattgctattttagtcctttaactaattttttggtatcgctttgatcccataactaaaaaaaagtccgttttggtattttaatt 9312146  T
208 tttgctccgttacatgttttagtcctttc 236  Q
    ||||||| || ||||||||||||||||||    
9312145 tttgctctgtcacatgttttagtcctttc 9312117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 237
Target Start/End: Original strand, 14816570 - 14816687
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||        ||| ||||||||||||||||||||| ||||||    
14816570 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccattactaaaaaaa-gtctgttttggtattttaacttttgttccgtt 14816668  T
219 acatgttttagtcctttcc 237  Q
     | |||||| || ||||||    
14816669 tcttgttttggttctttcc 14816687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 14829170 - 14829053
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||        ||| ||||||||||||||||||||| ||||||    
14829170 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccattactaaaaaaa-gtctgttttggtattttaacttttgttccgtt 14829072  T
219 acatgttttagtcctttcc 237  Q
     | |||||| || ||||||    
14829071 tcttgttttggttctttcc 14829053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 39567061 - 39567120
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
39567061 taggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 39567120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 39270853 - 39270795
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
39270853 aggcttaattgctattttcgtcccttaacttattttttggtatcgttttggtcccataa 39270795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 45378605 - 45378549
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||    
45378605 gcttaattgctattttcgtcccttaaataattttttggtatcgctttggtcccataa 45378549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 44633830 - 44633775
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| || ||||||||||||||||||||||| |||||||||||||    
44633830 cttaattgctattttggttccttaactaattttttggtatcgctttggtcccataa 44633775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 156
Target Start/End: Complemental strand, 14819430 - 14819391
117 taggcttaattgctattttagtcccttaactaattttttg 156  Q
14819430 taggcttaattgctattttagtcccttaactaattttttg 14819391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 39568564 - 39568509
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| ||||||||||||||||||| |||||| |||||| ||||||    
39568564 cttaattgctatttttgtcccttaactaattttttagtatcgttttggttccataa 39568509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 44632698 - 44632760
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccca 173  Q
    |||| ||||| |||||||||||||| ||| ||||| |||||||||||||||| ||||||||||    
44632698 aaaaaataggtttaattgctattttcgtctcttaattaattttttggtatcgttttggtccca 44632760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 178
Target Start/End: Original strand, 29802150 - 29802219
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
29802150 ataaaatttaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 29802219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 35 - 116
Target Start/End: Complemental strand, 7486408 - 7486326
35 gaatgattatgttgatgaagatta--agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||| ||| |||| ||||||||||  ||||||| |||||||| |||||||||||||||  |||||||| |||||||||||||||    
7486408 gaatcattgtgtttatgaagattaggagaagaagatgaagaa-ggtgagaaaaatattaggtgttggtggtttacaataaaata 7486326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 29 - 116
Target Start/End: Original strand, 41522488 - 41522588
29 ttttaggaatgattatgttgatgaagattaagaagaaaatg-------------aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaat 115  Q
    |||||||||||||||||||||||||||| |||||||| |||             |||||||||||||||||||||  |||||||| ||||||||||||||    
41522488 ttttaggaatgattatgttgatgaagatgaagaagaagatgggagaagatgataaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaat 41522587  T
116 a 116  Q
41522588 a 41522588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 4326034 - 4325973
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
4326034 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 4325973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 5822093 - 5822024
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| | |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
5822093 ataaaaaaaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 5822024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 107 - 172
Target Start/End: Original strand, 43633111 - 43633176
107 caataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||| |||||||||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||||    
43633111 caattaaatataggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtccc 43633176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 5876895 - 5876835
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
5876895 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 5876835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 12823259 - 12823319
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||| |||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
12823259 aaataaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 12823319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 21524716 - 21524656
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
21524716 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 21524656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45467436 - 45467496
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
45467436 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 45467496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 10134606 - 10134665
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
10134606 taggcttaaatgctctttttgtcccttaagtatttatttggtatcgctttggtcccataa 10134665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 29802631 - 29802576
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
29802631 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 29802576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 31445661 - 31445728
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31445661 aaaaaataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31445728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 36194996 - 36194937
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| |||| ||||||||||||||||   ||||  ||||||||||||||||||||    
36194996 taggcttaaatgctcttttagtcccttaacttgattttaagtatcggtttggtcccataa 36194937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 45377427 - 45377478
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    |||||||||| |||||| ||||||||| | |||||||||||||| |||||||    
45377427 ggcttaattgttattttcgtcccttaattgattttttggtatcgctttggtc 45377478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 162415 - 162461
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
162415 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 162461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 2222031 - 2221965
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
2222031 aaatataggtttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 2221965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 11760980 - 11760914
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11760980 aaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 11760914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3318098 - 3318037
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
3318098 taggcttaattactcttttggtcccttaatttattttttggtttcgttttggtcccttaact 3318037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7116470 - 7116531
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7116470 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 7116531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9807340 - 9807279
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
9807340 taggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 9807279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 11713198 - 11713259
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11713198 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 11713259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 12849962 - 12850023
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
12849962 taggctaaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 12850023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 13463206 - 13463153
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
13463206 ggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 13463153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 18476140 - 18476071
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||| |||| |||| |||||||||||| ||  || |||||| ||||||||| |||||    
18476140 ataaaatttaggcttaaatgctcttttggtcccttaactatttaatttgtatcgctttggtcccctaact 18476071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 33099030 - 33098969
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
33099030 taggcttaaatgctcttttggtcccttaactatttaattggtatcgatttggtcccttaact 33098969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 41836492 - 41836553
118 aggcttaattgctattttagtcccttaactaattt-tttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||||||||||||||||||||  ||||||||| ||||| ||| |||||    
41836492 aggcttaaatgctcttttagtcccttaactaatttaattggtatcgctttggacccttaact 41836553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 162726 - 162662
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||  ||||||||||| |||||| ||| ||| ||||||||| |||||    
162726 atataggcttaattactctttgggtcccttaacttatttttaggtttcgttttggtcccttaact 162662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 2221593 - 2221653
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
2221593 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 2221653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 7042021 - 7041957
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| ||||||  |||| |||||||||||| || | | |||||| |||||||||    
7042021 aataaaatataggctaaattgcatttttggtcccttaactatttatatagtatcgctttggtccc 7041957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 10398757 - 10398697
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
10398757 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 10398697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 11901554 - 11901494
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| | | ||||||||| |||||    
11901554 aggcttaattacttttttggtcccttaacttattttttggtttggttttggtcccttaact 11901494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 14054787 - 14054847
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
14054787 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtaccttaact 14054847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 22013461 - 22013521
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
22013461 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 22013521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26060105 - 26060165
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
26060105 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 26060165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 31933645 - 31933581
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||| |||| |||| |||||||||||   |||   ||||||||||||||||||||    
31933645 aaatataggcttaaatgctcttttggtcccttaacttgatttcaagtatcggtttggtcccataa 31933581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 31988513 - 31988573
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31988513 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 31988573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 41155073 - 41155013
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
41155073 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 41155013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 41387612 - 41387560
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggt 169  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||    
41387612 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggt 41387560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45123219 - 45123279
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45123219 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45123279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 45466360 - 45466300
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    ||||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||    
45466360 taaaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtc 45466300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 45467868 - 45467808
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| | | ||||||||| |||||    
45467868 aggcttaattactcttttggtcccttaacttattttttggttttgttttggtcccttaact 45467808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 38)
Name: chr2

Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 117 - 226
Target Start/End: Original strand, 7184879 - 7184989
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact-nnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||        ||||||||||||||||||||||||| ||||    
7184879 taggcttaattgctattttagtctcttaactaattttttggtatcggtttgatcccataactaaaaaaaaggtccgttttggtattttaacttttactcc 7184978  T
216 gttacatgttt 226  Q
    ||||| |||||    
7184979 gttacttgttt 7184989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 36889806 - 36889748
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
36889806 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 36889748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36888337 - 36888397
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
36888337 aggcttaattgctattttagtcccttagctaattttttggtatcggtttggtcccataact 36888397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 237
Target Start/End: Original strand, 13809426 - 13809542
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtta 219  Q
    |||||||| ||||||||| |||||||||||||||||||||||| |||| ||| |||| |       | |||||||| ||||||||||||||| ||||| |    
13809426 gcttaatttctattttaggcccttaactaattttttggtatcgctttgatcctataattaaaaaaag-tccgttttagtattttaacttttgttccgtca 13809524  T
220 catgttttagtcctttcc 237  Q
13809525 catgttttagtcctttcc 13809542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 236
Target Start/End: Complemental strand, 13810644 - 13810521
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaactttt 210  Q
    |||| |||||||||||||| ||||||||| |||||||||  ||||||||||| |||||||||||||||        ||||| ||||||||||||||||||    
13810644 aaaagataggcttaattgcaattttagtctcttaactaa--ttttggtatcgctttggtcccataactaaaaaaaagtccgatttggtattttaactttt 13810547  T
211 gctccgttacatgttttagtcctttc 236  Q
    | || ||| | |||||| ||| ||||    
13810546 gttctgtttcttgttttggtcatttc 13810521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 35738361 - 35738453
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttt 209  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||| |||||| ||||| ||       | ||| ||||||||||||||||||    
35738361 taggcttaattactattttcgttccttaactaattttttggtatcgctttggttccatatctaaaatttgatccattttggtattttaacttt 35738453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7031803 - 7031864
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
7031803 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 7031864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 7032224 - 7032155
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||||||| || |||| ||||||||||| ||||||| || ||| ||||||||| |||||    
7032224 ataacatataggcttaattactcttttggtcccttaacttattttttagtttcgttttggtcccttaact 7032155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 27516157 - 27516218
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
27516157 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 27516218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 7983472 - 7983508
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
7983472 ttttaggaatgattatgttgatgaagatgaagaagaa 7983508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26892463 - 26892523
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
26892463 aggcttaattgctcttttggtcccttaacttattttttggtttcgttttgatcccttaact 26892523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26897902 - 26897962
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
26897902 aggcttaattgctcttttggtcccttaacttattttttggtttcgttttgatcccttaact 26897962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 32194892 - 32194828
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
32194892 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 32194828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 34166841 - 34166901
117 taggcttaattgctattttagtcccttaacta-attttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| ||||||||| ||  |||||||||||| |||| |||||||||    
34166841 taggcttaattgctattttcgtcccttaaatattttttttggtatcagttttgtcccataa 34166901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 15130120 - 15130053
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||||| || ||||  |||||||||| |||||||||| ||| ||||||||| |||||    
15130120 aaaaaataggcttaattactcttttgatcccttaacttattttttggtttcgttttggtcccttaact 15130053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 31557091 - 31557150
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
31557091 ggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 31557150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 34618580 - 34618521
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
34618580 ggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 34618521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 35251488 - 35251555
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||||||||| || |||| ||||||||||| | |||||||| ||| ||||||||| |||||    
35251488 aaaataaaggcttaattactcttttggtcccttaacttaatttttggtttcgttttggtcccttaact 35251555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 38578242 - 38578187
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
38578242 taggcttaattactcttttggtcccttaacttattttttggtgtcgttttggtccc 38578187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 19297526 - 19297580
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
19297526 aggcttaattgctcttttcgtcccttaagttattatttggtatcgttttggtccc 19297580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 30785836 - 30785882
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
30785836 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 30785882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 31309692 - 31309646
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
31309692 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 31309646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 3603504 - 3603557
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||| |||||| |||||||||||| || ||| |||||| |||||||||    
3603504 ggcttaattgttattttcgtcccttaactatttatttagtatcgctttggtccc 3603557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 4602877 - 4602816
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
4602877 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 4602816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 111
Target Start/End: Original strand, 7983526 - 7983567
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaata 111  Q
    |||||||||||||||||||||  |||||||| ||||||||||    
7983526 aagaaaggtgagaaaaatattaggtgttggtggtttacaata 7983567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 11131248 - 11131183
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||| ||| |||| |||||||||||||| || || |||||||||| ||||||||| |||||    
11131248 aataaaggcataaatgctcttttagtcccttaagtatttatttggtatcgctttggtcccttaact 11131183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 171
Target Start/End: Original strand, 15044738 - 15044791
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||    
15044738 aggcttaagtgctattttggtcccttaactatttaattggtatcgctttggtcc 15044791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 18904597 - 18904658
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| ||||||| || ||| ||||||||| |||||    
18904597 taggcttaattactcttttggtcccttaacttatttttttgtttcgttttggtcccttaact 18904658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 27516601 - 27516540
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
27516601 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 27516540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 28190550 - 28190493
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||||| |||| ||||||||| | ||| |||||||||  |||||||||    
28190550 tataggcttaattgcttttttcgtcccttaagttattatttggtatcattttggtccc 28190493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 28958179 - 28958114
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| || |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
28958179 aatattggtttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 28958114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 31309827 - 31309766
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
31309827 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 31309766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 36099291 - 36099352
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
36099291 taggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 36099352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 3124327 - 3124387
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |  |||||||||||||||||||| | |||| ||  |||||||||||||||    
3124327 aggcttaattacatttttagtcccttaactaattatgtggtttcattttggtcccataact 3124387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 7182758 - 7182698
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
7182758 aggcttaattactcgtttggtcccttaacttattttttggtttcgttttggtcccttaact 7182698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 30786089 - 30786025
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||  | |||| || |||||||| |||||||||| ||| ||||||||| |||||    
30786089 atataggcttaattatttttttggttccttaacttattttttggtgtcgttttggtcccttaact 30786025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 35589229 - 35589165
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||  | | ||||||||| |||||    
35589229 atataggcttaattactcttttggtcccttaacttattttttggctttgttttggtcccttaact 35589165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 45001045 - 45001105
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||| ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||    
45001045 aaaatttaggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcc 45001105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 32)
Name: chr5

Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 117 - 237
Target Start/End: Complemental strand, 19718950 - 19718830
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| |||| ||| ||||||         |||||||||||||||||||||||  ||||    
19718950 taggcttaattgctattttagtcctttaactaattttttggtatcgctttgatcctataactaaaaaaaaatccgttttggtattttaacttttattccg 19718851  T
217 ttacatgttttagtcctttcc 237  Q
    | |||||||||||||||||||    
19718850 tcacatgttttagtcctttcc 19718830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 4959559 - 4959620
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
4959559 taggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 4959620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 11079690 - 11079629
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11079690 taggcttaaatgctattttggtcccttaactatttaattggtatcgttttggtcccttaact 11079629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 19798788 - 19798719
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||| |||| ||||||||| || || |||||||||  ||||||||| |||||    
19798788 ataaaatataggcttaaatgctcttttggtcccttaagtatttatttggtatcactttggtcccttaact 19798719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 22803650 - 22803589
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
22803650 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 22803589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 37812229 - 37812290
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
37812229 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 37812290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 42026724 - 42026663
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
42026724 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 42026663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 1155963 - 1156023
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
1155963 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 1156023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 7426990 - 7426954
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
7426990 ttttaggaatgattatgttgatgaagatgaagaagaa 7426954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 30112769 - 30112709
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||||||||||||| || ||  ||||||||| ||||||||| |||||    
30112769 aggcttaattgctcttttagtcccttaagtatttaattggtatcgctttggtcccttaact 30112709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 42026278 - 42026342
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
42026278 atataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 42026342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 4349495 - 4349554
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||| ||||||||||    
4349495 ggcttaattactcttttggtcccttaacttattttttggtttcgttttgatcccataact 4349554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 4349933 - 4349874
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
4349933 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 4349874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 6172399 - 6172340
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
6172399 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 6172340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 9040743 - 9040802
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
9040743 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 9040802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 9438237 - 9438296
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
9438237 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 9438296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 11079124 - 11079187
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| |||| ||||||||| ||||||| ||  ||||||||| ||||||||| |||||    
11079124 tataggcttaaatgctcttttagtccattaactatttaattggtatcgctttggtcccttaact 11079187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 24100326 - 24100267
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| |||||||||| || |||||    
24100326 ggcttaattactcttttggtcccttaacttattttttggtttcggtttggttccttaact 24100267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 31369985 - 31369926
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
31369985 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 31369926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 42382231 - 42382172
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
42382231 ggcttaattactcttttggtcccttaacttattttttggtttcgatttggtcccttaact 42382172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 116
Target Start/End: Complemental strand, 7426936 - 7426890
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||  ||| |||| |||||||||||||||    
7426936 aagaaaggtgagaaaaatattaggtgatggtagtttacaataaaata 7426890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 8127467 - 8127525
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||| ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
8127467 atattggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 8127525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 16670089 - 16670027
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
16670089 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 16670027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 43476499 - 43476437
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
43476499 ataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 43476437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 435552 - 435613
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
435552 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 435613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 6157557 - 6157496
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
6157557 taggcttaaatgctcttttggtcccttaactatttaattggtatcgatttggtcccttaact 6157496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 16791969 - 16792030
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
16791969 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 16792030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 21289590 - 21289529
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
21289590 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 21289529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 171
Target Start/End: Complemental strand, 25333247 - 25333194
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||    
25333247 aggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcc 25333194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 37812607 - 37812550
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
37812607 cttaattacttttttggtcccttaacttattttttggtttcgttttggtcccttaact 37812550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 17339794 - 17339854
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17339794 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 17339854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 24100759 - 24100699
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24100759 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24100699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0194

Target: scaffold0194; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 19304 - 19244
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||||| ||||||||||||||||| |||||||||||||||||||||    
19304 aggcttaattgttactttagttccttaactaattttttgatatcggtttggtcccataact 19244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 18070 - 18127
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||||||||||||||||||||  |||||||||||||| |||||||    
18070 cttaattactattttagtcccttaactaatttttgagtatcggtttggtctcataact 18127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: scaffold0031

Target: scaffold0031; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 129488 - 129420
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| ||||||||||| |||||| ||||||||||| |||||||||||||  |||||||||||||    
129488 aataaaatacaggcttaattgttattttcgtcccttaacttattttttggtatcactttggtcccataa 129420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 123422 - 123481
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||| ||||||| | |||||||||||||    
123422 taggcttaattgctattttcgtcccttaactaatttcttggtattgctttggtcccataa 123481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 134298 - 134357
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||| ||||||| | |||||||||||||    
134298 taggcttaattgctattttcgtcccttaactaatttcttggtattgctttggtcccataa 134357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0025

Target: scaffold0025; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 59 - 116
Target Start/End: Original strand, 56508 - 56565
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  |||||||| |||||||||||||||    
56508 agaagaagatgaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 56565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0295 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0295

Target: scaffold0295; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 8275 - 8215
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
8275 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 8215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0006

Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 83445 - 83385
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
83445 aggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 83385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0005

Target: scaffold0005; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 1470 - 1534
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
1470 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 1534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0352

Target: scaffold0352; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 11489 - 11423
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| || |||| ||||||||||| | |||||||| ||| |||||| || |||||    
11489 aaatataggcttaattactcttttggtcccttaacttaatttttggtttcgttttggttccttaact 11423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0220 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0220

Target: scaffold0220; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 25963 - 26020
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
25963 ggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtcccataa 26020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135 (Bit Score: 30; Significance: 0.0000001; HSPs: 6)
Name: scaffold0135

Target: scaffold0135; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 5917 - 5856
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
5917 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 5856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 10132 - 10071
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
10132 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 10071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 14347 - 14286
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
14347 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 14286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 18562 - 18501
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
18562 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 18501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 22777 - 22716
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
22777 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 22716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 26992 - 26931
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
26992 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 26931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0054

Target: scaffold0054; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 57020 - 57081
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| | |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
57020 taggcttaattgttcttttggtcccttaactatttaattggtatcgctttggtcccttaact 57081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 57617 - 57557
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| | |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
57617 aggcttaattgttcttttggtcccttaactatttaattggtatcgctttggtcccttaact 57557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0026

Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 100040 - 99979
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
100040 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtaccttaact 99979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0017

Target: scaffold0017; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 172967 - 172910
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
172967 cttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 172910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0014

Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 230871 - 230931
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
230871 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 230931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0012

Target: scaffold0012; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 144717 - 144777
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
144717 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 144777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009

Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 242224 - 242160
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||  ||||||||| |||||    
242224 atataggcttaaatgctcttttggtcccttaactatttaattggtatcactttggtcccttaact 242160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0002

Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 162
Target Start/End: Complemental strand, 429211 - 429163
114 atataggcttaattgctattttagtcccttaactaattttttggtatcg 162  Q
    ||||||||||||||||| |||| ||||||||| | ||| ||||||||||    
429211 atataggcttaattgcttttttggtcccttaagttattatttggtatcg 429163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149237 times since January 2019
Visitors: 1516