View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_14 (Length: 303)

Name: NF1565_high_14
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_14
NF1565_high_14
[»] chr4 (2 HSPs)
chr4 (1-283)||(41883754-41884035)
chr4 (7-71)||(41883714-41883778)


Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 41883754 - 41884035
Alignment:
1 cgacataaaattattcttattagtacatgtgtaatattacacatttaaacatagaattattcttattagtaattgcaggtgagttattgtgataagttaa 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41883754 cgacataaaattattcttattagtaca-gtgtaatattacacatttaaacataaaattattcttattagtaattgcaggtgagttattgtgataagttaa 41883852  T
101 tagtaaaatacaataagttaggggggttggtatacatccatctttagaatgaagttagtgaatagtgagtgcttacgggtaaaagattttttatcttctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41883853 tagtaaaatacaataagttaggggggttggtatacatccatctttagaatgaagttagtgaatagtgagtgcttacgggtaaaagattttttatcttctt 41883952  T
201 catatgtgattgaaatttttagattttacgtcacaggttacctttagacatttgtcattgctagttcctactccttcatttga 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
41883953 catatgtgattgaaatttttagattttacgtcacaggttacctttagacatttgtcattgctatttcctactccttcatttga 41884035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 41883714 - 41883778
Alignment:
7 aaaattattcttattagtacatgtgtaatattacacatttaaacatagaattattcttattagta 71  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||| |||||||||||||||||    
41883714 aaaattattcttattagtacatgtgtaatattacacatttcgacataaaattattcttattagta 41883778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142316 times since January 2019
Visitors: 1480