View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_15 (Length: 271)

Name: NF1565_high_15
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_15
NF1565_high_15
[»] chr4 (1 HSPs)
chr4 (1-263)||(41883475-41883737)
[»] chr5 (2 HSPs)
chr5 (95-187)||(10267704-10267796)
chr5 (21-64)||(10267915-10267958)
[»] chr2 (1 HSPs)
chr2 (227-255)||(36372315-36372343)


Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 41883737 - 41883475
Alignment:
1 acatgtactaataagaataattttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41883737 acatgtactaataagaataattttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaa 41883638  T
101 tggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41883637 tggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaag 41883538  T
201 atgaatgttgtaggtggtacctgcaaaattcactactgccgcaacagtcaagtgcttcatctc 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||    
41883537 atgaatgttgtaggtggtacctgcaaaattcactactgccgcaacagtcaggtgcttcttctc 41883475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 95 - 187
Target Start/End: Complemental strand, 10267796 - 10267704
Alignment:
95 tttcaatggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttatta 187  Q
    |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||    
10267796 tttcaatggcaacaccaatgggaagtgacacatggaaagcccatttggctatggcaatggtgcagctattcaatggtggttaccacgttatta 10267704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 10267958 - 10267915
Alignment:
21 ttttgtgactttaacatgaaggaaaggagccatcaggtttggta 64  Q
    |||||||||||||||| ||||||||||| |||||||||||||||    
10267958 ttttgtgactttaacacgaaggaaaggaaccatcaggtttggta 10267915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 255
Target Start/End: Original strand, 36372315 - 36372343
Alignment:
227 aattcactactgccgcaacagtcaagtgc 255  Q
    |||||||||||||||||||||||||||||    
36372315 aattcactactgccgcaacagtcaagtgc 36372343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149946 times since January 2019
Visitors: 1518