View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_17 (Length: 260)

Name: NF1565_high_17
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_17
NF1565_high_17
[»] chr2 (1 HSPs)
chr2 (8-244)||(36331784-36332020)
[»] chr4 (1 HSPs)
chr4 (103-187)||(19275472-19275556)
[»] chr8 (1 HSPs)
chr8 (96-142)||(40631994-40632040)


Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 244
Target Start/End: Complemental strand, 36332020 - 36331784
Alignment:
8 acattatactaaattaaatactatacaaaccaaaatgaataaaacagtactgtctcatacattaagcttgatgaaggattattattattaatcctatgat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36332020 acattatactaaattaaatactatacaaaccaaaatgaataaaacagtactgtctcatacattaagcttgatgaaggattattattattaatcctatgat 36331921  T
108 gaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcataaatattctttagaccattc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36331920 gaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcataaatattctttagaccattc 36331821  T
208 tcatatcctataaagcaaaattcaattcacataaaca 244  Q
    |||||||||||||||||||||||||||||||||||||    
36331820 tcatatcctataaagcaaaattcaattcacataaaca 36331784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 187
Target Start/End: Complemental strand, 19275556 - 19275472
Alignment:
103 atgatgaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcat 187  Q
    |||| ||| ||||||||||||||| ||| ||||| |||| | |||||| ||| ||| |||||| ||||||||||| |||||||||    
19275556 atgaagaactccataagggacatgttgacttgaaggtccagactcagacaaaccaatttctccaattctttggctagccatgcat 19275472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 142
Target Start/End: Original strand, 40631994 - 40632040
Alignment:
96 taatcctatgatgaattccataagggacatgatgagttgaatgtcct 142  Q
    |||||||||||||||| |||||||| ||||||| | |||||||||||    
40631994 taatcctatgatgaataccataaggaacatgattacttgaatgtcct 40632040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141943 times since January 2019
Visitors: 1479