View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_2 (Length: 471)

Name: NF1565_high_2
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_2
NF1565_high_2
[»] chr4 (2 HSPs)
chr4 (10-454)||(53581252-53581696)
chr4 (60-199)||(53568003-53568142)


Alignment Details
Target: chr4 (Bit Score: 405; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 10 - 454
Target Start/End: Original strand, 53581252 - 53581696
Alignment:
10 acatcatcatgctttatgttaggaagaaactcatcatagtcatttgatccagaaaataaagcagcattttttctgcttgtgcacaagaatgaaaatgtaa 109  Q
    ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||    
53581252 acatcataatgctttatgttaggaagaaactcatcatagtcttttgatccagaaaataaagcggcatttgttctgcttgtgcacaagaatgaaaatgtaa 53581351  T
110 ctttatgagcatctacagcaatccttctagcaaggctaaggagtggacctgcatgtgttccaaatgggaatgccaaaatggccacatgtagtttttcaac 209  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
53581352 ctttatgagcatctacagcaatccttctagcaaggttaaggagtggacctgcatgtgttccaaatgggaatgccaaaacggccacatgtagtttttcaac 53581451  T
210 attaactgattcacctttatctctagacatccagtttttcaaacgtgcaattgaaaacatgtataactaagatcaatctttgatgtttttgtggccaaca 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53581452 attaactgattcacctttatctctagacatccagtttttcaaacgtgcaattgaaaacatgtataactaagatcaatctttgatgtttttgtggccaaca 53581551  T
310 ctacttatttttgggtggtctttatatgttgcaagaaagaaacaaactagaagaaaagttacacatatgtggttgaaaaataatagtaacaaattattaa 409  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||    
53581552 ctgcttatttttgggtggtctttatatgttgcaagaaagaaacaaactagaagaaaagttacacatatgtggttggaaaataatagtaacaaattataaa 53581651  T
410 tgttaatataaggaggtgcaatgagcgtgacggtagttaggtgtt 454  Q
    |||||||||||||||||||||||||||||| ||||||||||||||    
53581652 tgttaatataaggaggtgcaatgagcgtgatggtagttaggtgtt 53581696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 60 - 199
Target Start/End: Original strand, 53568003 - 53568142
Alignment:
60 agaaaataaagcagcattttttctgcttgtgcacaagaatgaaaatgtaactttatgagcatctacagcaatccttctagcaaggctaaggagtggacct 159  Q
    ||||||||||| | ||||| || || ||||||| ||||||||||||||||||||| |||| |||  ||||||  || |  | ||||||||||||||| |     
53568003 agaaaataaagtatcatttgttgtggttgtgcagaagaatgaaaatgtaactttaggagcctctgtagcaatttttttcactaggctaaggagtggagca 53568102  T
160 gcatgtgttccaaatgggaatgccaaaatggccacatgta 199  Q
    |||||||| |||||||||||||||||||  ||||||||||    
53568103 gcatgtgtgccaaatgggaatgccaaaacagccacatgta 53568142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141994 times since January 2019
Visitors: 1479