View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_20 (Length: 252)

Name: NF1565_high_20
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_20
NF1565_high_20
[»] chr2 (1 HSPs)
chr2 (18-236)||(43742919-43743131)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 43742919 - 43743131
Alignment:
18 acaacttagtactttgaagagtttacatcaatgataagatatttgatgtagtacggagtttactcacacaaagagaatgatgacgtttctagctcaatac 117  Q
    ||||||| |||||||||||||||||||||||||||||||||        ||||| ||||||||||||||| |||||||||||||||||||||||||||||    
43742919 acaacttggtactttgaagagtttacatcaatgataagataca------agtacagagtttactcacacagagagaatgatgacgtttctagctcaatac 43743012  T
118 aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43743013 aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg 43743112  T
218 ctatttcacatcggaaagt 236  Q
    |||||||| || |||||||    
43743113 ctatttcatatgggaaagt 43743131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142397 times since January 2019
Visitors: 1480