View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_21 (Length: 250)

Name: NF1565_high_21
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_21
NF1565_high_21
[»] chr3 (5 HSPs)
chr3 (1-206)||(8434652-8434840)
chr3 (62-224)||(3817382-3817543)
chr3 (88-223)||(27149345-27149480)
chr3 (1-70)||(3811455-3811524)
chr3 (1-60)||(27149472-27149531)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 8434840 - 8434652
Alignment:
1 tcaaaactctcactatcaatttcatgtgaatcaaaagactcaggaagctcattcaaatcaaaaagatttttcagttttgcatgagacttcaaatcatctt 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8434840 tcaaaactctcactatcaatttcatatgaatcaaaagactcaggaagctcattcaaatcaaaaagatttttcagttttgcatgagacttcaaatcatctt 8434741  T
101 cattagagttattagactccatgcccatgatatgtgagtatagatgataaccataacacatgaaagtgaatgatgaatatattaatagcttgttggcatg 200  Q
    ||||||||||||||||||||||||||                 | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
8434740 cattagagttattagactccatgccc-----------------aagataaccataacacatgaaagtgaatgatgcatatattaatagcttgttggcatg 8434658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 62 - 224
Target Start/End: Original strand, 3817382 - 3817543
Alignment:
62 aaagatttttcagttttgcatgagacttcaaatcatcttcattagagttattagactccatgcccatgatatgtgagtatagatgataaccataacacat 161  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||    
3817382 aaagatttttcagttttgtatgagacttcaaatcatcttcattagagttattagactccatgcccatgatatgtgagtacagaagataaccataacacat 3817481  T
162 gaaagtgaatgatgaatatattaatagcttgttggcatgtgtgtaccccgccaaatagttttc 224  Q
     ||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||    
3817482 caaagtgaatgatgcatatattaatag-ttgttggcttgtgtgtaccccgccaaatagttttc 3817543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 88 - 223
Target Start/End: Complemental strand, 27149480 - 27149345
Alignment:
88 ttcaaatcatcttcattagagttattagactccatgcccatgatatgtgagtatagatgataaccataacacatgaaagtgaatgatgaatatattaata 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||    
27149480 ttcaaatcatcttcattagagttattagactccatgcccatgatatgtgagtagagaagataaccataacacatgaaagtgaatgatgcatatattaata 27149381  T
188 gcttgttggcatgtgtgtaccccgccaaatagtttt 223  Q
    |||||||||| |||||||||||||||||||||||||    
27149380 gcttgttggcctgtgtgtaccccgccaaatagtttt 27149345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3811455 - 3811524
Alignment:
1 tcaaaactctcactatcaatttcatgtgaatcaaaagactcaggaagctcattcaaatcaaaaagatttt 70  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3811455 tcaaaactctcactatcaatttcatatgaatcaaaagactcaggaagctcattcaaatcaaaaagatttt 3811524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 27149531 - 27149472
Alignment:
1 tcaaaactctcactatcaatttcatgtgaatcaaaagactcaggaagctcattcaaatca 60  Q
    ||||||||||||||||||||||||| |||||  ||||| |||||||||||||||||||||    
27149531 tcaaaactctcactatcaatttcatatgaattcaaagattcaggaagctcattcaaatca 27149472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150199 times since January 2019
Visitors: 1518