View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_23 (Length: 241)

Name: NF1565_high_23
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_23
[»] chr5 (1 HSPs)
chr5 (18-234)||(7037658-7037874)

Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 7037874 - 7037658
18 ggtgcgacaaggaactaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggtggaagtatcacacatctg 117  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||     
7037874 ggtgcgacaaggaaccaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggcgaaagtatcacacatcta 7037775  T
118 cctctcttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagattactcccctagttgttttggcggtgtatcctcctc 217  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||| |||||||||||||    
7037774 cctctgttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagatgactccgttagttgttttggcagtgtatcctcctc 7037675  T
218 ctaatctatctctgctc 234  Q
    ||||||||||| |||||    
7037674 ctaatctatctttgctc 7037658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149155 times since January 2019
Visitors: 1516