View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_24 (Length: 239)

Name: NF1565_high_24
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_24
NF1565_high_24
[»] chr6 (1 HSPs)
chr6 (1-223)||(31742488-31742710)
[»] chr3 (4 HSPs)
chr3 (1-223)||(5165007-5165228)
chr3 (1-223)||(3804726-3804931)
chr3 (1-136)||(8435120-8435255)
chr3 (187-223)||(27149782-27149818)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 31742488 - 31742710
Alignment:
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||         
31742488 agagaatgactggatggttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtcgaaattttttggaaaa 31742587  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||    
31742588 aagtggtgggagtttgcctacttttttcaatttgaaatccaaatgagctgtgagaatatcaatagccacattaaaccataataaaaccgatgtattcttg 31742687  T
201 tgaagagggagaggcgtgtttgt 223  Q
    |||||||||||||||||||||||    
31742688 tgaagagggagaggcgtgtttgt 31742710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 5165007 - 5165228
Alignment:
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||         
5165007 agagaatgacgggatgtttaaacttcatttctactctatttaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttctggaaaa 5165106  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
5165107 aagtggtgggagtttgcctacttttttcaatttgaaatccaaatgagctgtgagaatatcaatagccacattaaaccagaataaaactgatgtattcttg 5165206  T
201 tgaagagggagaggcgtgtttgt 223  Q
    |||||| ||||||| ||||||||    
5165207 tgaaga-ggagaggtgtgtttgt 5165228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3804931 - 3804726
Alignment:
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||         
3804931 agagaatgactagatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttctggaaaa 3804832  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||          ||||||||| |||||||||||    
3804831 aagtggtgggagtttgcctacttttttcaatttgaaatccaaa-------tgagaatatcaatagccac----------aataaaacctatgtattcttg 3804749  T
201 tgaagagggagaggcgtgtttgt 223  Q
    ||||||||||||| |||||||||    
3804748 tgaagagggagagacgtgtttgt 3804726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 8435120 - 8435255
Alignment:
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||         
8435120 agagaatgactggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaaatttatttgctcaaaattttggtgggaattttatgaaaaa 8435219  T
101 nngtggtgggagtttgcctacttttttcaatttgaa 136  Q
      ||||||||||||||||||||||||||||||||||    
8435220 aagtggtgggagtttgcctacttttttcaatttgaa 8435255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 27149782 - 27149818
Alignment:
187 ccgatgtattcttgtgaagagggagaggcgtgtttgt 223  Q
    |||||||||||||||||||||||||||||||||||||    
27149782 ccgatgtattcttgtgaagagggagaggcgtgtttgt 27149818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142240 times since January 2019
Visitors: 1479