View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_25 (Length: 234)

Name: NF1565_high_25
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_25
NF1565_high_25
[»] chr2 (2 HSPs)
chr2 (1-223)||(3576311-3576533)
chr2 (32-223)||(3576019-3576210)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3576311 - 3576533
Alignment:
1 tttgttgtatacgccgattaaaacctacgggcaaccgctgcttgaaatcctctttgccaatcaacaagaagatcctacttgctctctttaaacacaagca 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||    
3576311 tttgttgtatacgccgattaaaacctacaggcaaccgctgcttgaaatcctctttgccaatcaacaagaagatcctactcgttttctttaaacacaagca 3576410  T
101 cggggtccacaagggtattaacacaaattactatctactgttcaacaaatacaaatatgcataaacaaagcaccaaaacttttataaatcatggtatctg 200  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |    
3576411 ctgggtccacaagggtattaacacaaattactatctactgttcaacaaatacaaatatgcataaacaaagcaccaaaacttttataaatcacggtaccag 3576510  T
201 aaattgattagaagcaatatttg 223  Q
    |||||||||||||||||||||||    
3576511 aaattgattagaagcaatatttg 3576533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 3576210 - 3576019
Alignment:
32 caaccgctgcttgaaatcctctttgccaatcaacaagaagatcctacttgctctctttaaacacaagcacggggtccacaagggtattaacacaaattac 131  Q
    ||||||||||||||||||||||||| ||||||||||||||||| |||| | | ||||||||||||||||| |||||||||||||||||||||||||||||    
3576210 caaccgctgcttgaaatcctctttgtcaatcaacaagaagatcttactcgttttctttaaacacaagcactgggtccacaagggtattaacacaaattac 3576111  T
132 tatctactgttcaacaaatacaaatatgcataaacaaagcaccaaaacttttataaatcatggtatctgaaattgattagaagcaatatttg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||    
3576110 tatctactgttcaacaaatacaaatatgcataaacaaagcaccaaaacttttataaatcacggtacctgaaattgattagaagcaatatttg 3576019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137298 times since January 2019
Visitors: 1446