View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_26 (Length: 227)

Name: NF1565_high_26
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_26
[»] chr5 (1 HSPs)
chr5 (1-213)||(10812561-10812776)

Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10812561 - 10812776
1 atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggaccgttggatcaagatcggataaatcatgatcata-ttttttgttttaa 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||    
10812561 atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggacggttggatcaagatcggataaatcatgatcatatttttttgttttaa 10812660  T
100 atttatcttgcaaagtg-tgggaaatgtgaaattaagagaaaattttaggacaactcggagtatact-nnnnnnnngagaactcataaatttaatggagt 197  Q
    | ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||         ||||||||| ||||||||||||||    
10812661 aattatcttgcaaagtgttgggaaatgtgaaattaagagaaaattttaggataactcggagtatactaaaaaaaaagagaactcacaaatttaatggagt 10812760  T
198 tcggccctcaatacct 213  Q
10812761 tcggccctcaatacct 10812776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142451 times since January 2019
Visitors: 1480