View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_27 (Length: 209)

Name: NF1565_high_27
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_27
NF1565_high_27
[»] chr2 (2 HSPs)
chr2 (18-190)||(2820204-2820377)
chr2 (36-188)||(2827550-2827707)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 2820204 - 2820377
Alignment:
18 aacttgtgctaaacttattgctaaccctgtcatccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2820204 aacttgtgctaaacttattgctaaccctgtcatccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcc 2820303  T
118 cctaatcttttgttttgataatcaatgtggttttatt-aatgatgacacatttggtagttctttttaggtacac 190  Q
    ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
2820304 cctaatcttttgttttgataatccatgtggttttattgaatgatgacacatttggtagttctttttaggtacac 2820377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 36 - 188
Target Start/End: Original strand, 2827550 - 2827707
Alignment:
36 tgctaaccctgtca----tccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcccctaatcttttgtt 131  Q
    ||||||||||||||    ||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
2827550 tgctaaccctgtcaattgtccccggattcttgtatgaaaatactggatcacatcagctaggaaaatggttaattcattatcatttccctaatcttttgtt 2827649  T
132 ttgataatcaatgtggttttatta-atgatgacacatttggtagttctttttaggtac 188  Q
    || |||||| |||||||||||||| |||||||||||||||||||||||||||||||||    
2827650 ttaataatccatgtggttttattacatgatgacacatttggtagttctttttaggtac 2827707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 148959 times since January 2019
Visitors: 1515