View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_29 (Length: 207)

Name: NF1565_high_29
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_29
[»] chr3 (3 HSPs)
chr3 (19-186)||(3959692-3959860)
chr3 (30-86)||(39181791-39181847)
chr3 (30-76)||(49876118-49876164)
[»] chr1 (1 HSPs)
chr1 (19-186)||(14000972-14001138)
[»] chr5 (1 HSPs)
chr5 (30-84)||(6637365-6637419)
[»] chr4 (1 HSPs)
chr4 (30-86)||(26015136-26015192)
[»] chr7 (1 HSPs)
chr7 (19-86)||(26982397-26982464)
[»] chr8 (1 HSPs)
chr8 (19-79)||(43065333-43065393)

Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 3959860 - 3959692
19 aaataacctattagaaacatttacaa-catttttcttcaacgaccacatcgataaatatttgaccttatgccagatcagctcgaaaaccactatttgatg 117  Q
    |||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||  ||||||||||||||||    
3959860 aaataacctaatagaaacatttacaaacatttttcttcaaccaccacatcgataaatatttgaccttatgccagatcaactcagaaaccactatttgatg 3959761  T
118 catactcttatctcgtacgaattaaaacttcatcgcaattcttgggaaatagcaatatatgtattatta 186  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
3959760 catactcttatctcatacgaattaaaacttcatcgcaatttttgggaaatagcaatatatgtattatta 3959692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 39181791 - 39181847
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    ||||||||||||||| |||||||||||   |||||||||||||||||||||||||||    
39181791 tagaaacatttacaatatttttcttcagtcaccacatcgataaatatttgaccttat 39181847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 49876118 - 49876164
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatat 76  Q
    |||||||| |||||||||||||||||||| ||| |||||||||||||    
49876118 tagaaacagttacaacatttttcttcaaccaccgcatcgataaatat 49876164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 14000972 - 14001138
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttatgccagatcagctcgaaaaccactatttgatgc 118  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||  ||||||||||||||| |    
14000972 aaataacctaatagaaacatttacaacatttttcttcaaccaccacatcgataaatatttgaccttatgccatatcaactcagaaaccactatttgat-c 14001070  T
119 atactcttatctcgtacgaattaaaacttcatcgcaattcttgggaaatagcaatatatgtattatta 186  Q
    ||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
14001071 atactcttatctcatacgaattaaaacttcatcgcaatttttggggaatagcaatatatgtattatta 14001138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 6637365 - 6637419
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgacctt 84  Q
    |||||||||| |||||||||||||||| | |||||||||||||||||||||||||    
6637365 tagaaacattgacaacatttttcttcagccaccacatcgataaatatttgacctt 6637419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26015192 - 26015136
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    ||||||||||||| ||||||||||||||   || |||||||||||||||||||||||    
26015192 tagaaacatttacgacatttttcttcaatccccgcatcgataaatatttgaccttat 26015136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 26982464 - 26982397
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    |||||||| | |||||| |||||||| ||||||||||| | ||||||| |||||||| ||||||||||    
26982464 aaataacccaatagaaatatttacaatatttttcttcagctaccacattgataaatacttgaccttat 26982397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 43065393 - 43065333
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttg 79  Q
    ||||||| || |||||||||||||| |||||||||  | | ||||||||||||||||||||    
43065393 aaataacataatagaaacatttacatcatttttctatagccaccacatcgataaatatttg 43065333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142200 times since January 2019
Visitors: 1479