View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_30 (Length: 204)

Name: NF1565_high_30
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_30
[»] chr5 (1 HSPs)
chr5 (1-199)||(9424266-9424464)

Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 9424464 - 9424266
1 agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca 100  Q
9424464 agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca 9424365  T
101 agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacaggttctgctcgttca 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||    
9424364 agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacagtggctgctcgttca 9424266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142333 times since January 2019
Visitors: 1480