View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_32 (Length: 203)

Name: NF1565_high_32
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_32
NF1565_high_32
[»] chr3 (1 HSPs)
chr3 (22-189)||(4191748-4191915)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 4191748 - 4191915
Alignment:
22 acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacaatcc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4191748 acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacgatcc 4191847  T
122 aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4191848 aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc 4191915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 148912 times since January 2019
Visitors: 1515