View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_5 (Length: 424)

Name: NF1565_high_5
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_5
NF1565_high_5
[»] chr5 (1 HSPs)
chr5 (17-409)||(24400738-24401130)


Alignment Details
Target: chr5 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 17 - 409
Target Start/End: Original strand, 24400738 - 24401130
Alignment:
17 atgtttaacgtacatgttcttttccggtatgaatcataccacagatgacaaaacagcttgaatctgaatgaacacatgaa-cataaacctag-aactcaa 114  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||     
24400738 atgtttgacgtacatgttcttttccggtatgaatcataccacagatgacaaaacagcttgaatctgaatgaacacaggaaacataaacctaggaactca- 24400836  T
115 gtgtatttggaggagaggaaaggattgcagaaaaatgcaaatgagagagtatgtatatgtgtgtaccatcttgtgttactagcaattattatatatatat 214  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
24400837 gtgtatttggaggagagaaaaggattgcagaaaaatgcaaatgagagagtatgtatatgtttgtaccgtcttgtgttactagcaattattatatatatat 24400936  T
215 tggtaagtgagtgttttgttgaaaaacaaaggaagggtagtgtgagtggttgttggttccttatggcatgtgtgtaaaataaacgtgatcaacaaccagc 314  Q
    ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24400937 tggtaagtgagtgatttgttgaaaaacaaaggaagggtagtgtaagtggttgttggttccttatggcatgtgtgtaaaataaacgtgatcaacaaccagc 24401036  T
315 aactaagggcactttagcaaataagcataagttggtaaatatcctgataacaataaaaatgagtttgtttgtattctcagtctcaccggtctctg 409  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
24401037 aactaagggcactttagcaaataagcataagttggtaaatat-ctgataacaataaaaatgagtttgtttgtattctcagtctcaccggtctctg 24401130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150095 times since January 2019
Visitors: 1518