View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_6 (Length: 389)

Name: NF1565_high_6
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_6
[»] chr7 (17 HSPs)
chr7 (19-372)||(8457086-8457441)
chr7 (23-368)||(18815299-18815646)
chr7 (19-370)||(27987471-27987821)
chr7 (168-323)||(24819811-24819966)
chr7 (57-312)||(5196636-5196891)
chr7 (174-301)||(40891739-40891866)
chr7 (150-323)||(12121682-12121855)
chr7 (174-298)||(586904-587028)
chr7 (141-226)||(20705542-20705627)
chr7 (141-226)||(20873586-20873671)
chr7 (177-241)||(22865783-22865847)
chr7 (177-241)||(47548969-47549033)
chr7 (177-241)||(47553412-47553476)
chr7 (173-230)||(27869019-27869076)
chr7 (168-319)||(34981961-34982112)
chr7 (168-264)||(36575394-36575490)
chr7 (168-301)||(37075565-37075698)
[»] chr1 (9 HSPs)
chr1 (19-370)||(26995929-26996281)
chr1 (23-370)||(24544962-24545310)
chr1 (19-231)||(40392670-40392882)
chr1 (54-304)||(28520809-28521059)
chr1 (168-323)||(10004045-10004200)
chr1 (168-323)||(27030066-27030221)
chr1 (174-301)||(41342783-41342910)
chr1 (177-231)||(37668976-37669030)
chr1 (174-301)||(49369887-49370014)
[»] scaffold0289 (1 HSPs)
scaffold0289 (19-370)||(11030-11382)
[»] chr4 (18 HSPs)
chr4 (19-333)||(24059608-24059924)
chr4 (200-370)||(25135450-25135622)
chr4 (150-304)||(23158122-23158276)
chr4 (150-304)||(36279175-36279329)
chr4 (150-323)||(51872781-51872954)
chr4 (174-247)||(8111038-8111111)
chr4 (174-319)||(17826738-17826883)
chr4 (168-319)||(15649024-15649175)
chr4 (174-301)||(18116357-18116484)
chr4 (174-304)||(29123410-29123541)
chr4 (174-247)||(4303231-4303304)
chr4 (176-248)||(12915913-12915985)
chr4 (177-241)||(36951324-36951388)
chr4 (177-241)||(50693789-50693853)
chr4 (174-229)||(3621622-3621677)
chr4 (174-304)||(22340699-22340829)
chr4 (53-182)||(25135278-25135407)
chr4 (177-241)||(17469159-17469223)
[»] chr6 (6 HSPs)
chr6 (174-316)||(17228056-17228198)
chr6 (168-323)||(2894351-2894506)
chr6 (173-265)||(7218361-7218453)
chr6 (150-304)||(18295368-18295522)
chr6 (174-319)||(667385-667530)
chr6 (174-229)||(28604934-28604989)
[»] chr2 (9 HSPs)
chr2 (19-158)||(20007463-20007602)
chr2 (150-304)||(30275985-30276139)
chr2 (154-316)||(1258561-1258723)
chr2 (168-304)||(23384957-23385093)
chr2 (173-304)||(32349993-32350124)
chr2 (168-304)||(21963522-21963658)
chr2 (168-304)||(21964707-21964843)
chr2 (174-247)||(38938592-38938665)
chr2 (168-223)||(27914654-27914709)
[»] chr3 (14 HSPs)
chr3 (150-322)||(3514780-3514952)
chr3 (174-322)||(48547674-48547822)
chr3 (168-316)||(9819174-9819322)
chr3 (174-304)||(23603382-23603512)
chr3 (174-301)||(23571596-23571723)
chr3 (174-304)||(42462840-42462970)
chr3 (174-247)||(8595377-8595450)
chr3 (177-241)||(16664099-16664163)
chr3 (177-241)||(39632867-39632931)
chr3 (153-241)||(10754162-10754250)
chr3 (177-241)||(52196409-52196473)
chr3 (168-247)||(17153836-17153915)
chr3 (174-301)||(42459278-42459405)
chr3 (168-229)||(53152132-53152193)
[»] chr8 (5 HSPs)
chr8 (174-322)||(26077680-26077828)
chr8 (153-241)||(10801715-10801803)
chr8 (184-322)||(31423195-31423333)
chr8 (178-229)||(26390289-26390340)
chr8 (174-229)||(29532477-29532532)
[»] scaffold0041 (1 HSPs)
scaffold0041 (174-301)||(74418-74545)
[»] scaffold0032 (1 HSPs)
scaffold0032 (174-304)||(58368-58498)
[»] scaffold0003 (1 HSPs)
scaffold0003 (174-265)||(224737-224828)
[»] chr5 (9 HSPs)
chr5 (174-247)||(11266145-11266218)
chr5 (174-247)||(27891818-27891891)
chr5 (177-241)||(29322916-29322980)
chr5 (174-231)||(29150424-29150481)
chr5 (168-304)||(5824941-5825077)
chr5 (173-316)||(31962632-31962775)
chr5 (177-226)||(8896369-8896418)
chr5 (177-226)||(38931892-38931941)
chr5 (168-220)||(6678632-6678684)

Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 17)
Name: chr7

Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 372
Target Start/End: Complemental strand, 8457441 - 8457086
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
8457441 gaactgtattgatatcaagtcaatgggatatcagaagccacaaacgaccgtaatgatcacaattaaaaaacaaatggtttttatcctctacacccccaca 8457342  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
8457341 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccgcagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 8457242  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
8457241 ttaacctttaacgaaaccgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcacgg 8457142  T
319 tgtatttgttggaagggtaaagttttcac--acacctatcagccatgtcaacctac 372  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
8457141 tgtatttgttggaagggtaaagttttcacacacacctatcagccatgtcaacctac 8457086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 368
Target Start/End: Complemental strand, 18815646 - 18815299
23 tgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaa 122  Q
    |||||||||| |||| ||| ||||||| ||||| || ||||||| ||| |||||||||||| |||||||||||| | | ||||||||| |||||||||||    
18815646 tgtattgataccaagccaatgggatatcagaagtcaaaaacgactgtagtgatcacacttacaaaacaaatggtctttgtcctctacagccccacatgaa 18815547  T
123 gtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaa 222  Q
      | ||||||||| ||| ||||||||||||||||| ||||||| ||||| |||||||||| ||||||||||||||||||||||| ||||||| |||||||    
18815546 accgcacaagataccagggaaacatccagaacattcctcttcctcagattatcctttgtagcaagtctattcagaaagagacgctagacaaatatattaa 18815447  T
223 cctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||||||| ||| |||||||||||| ||||||||||||||||||||||||| |||  |||||||| ||||||||||||||| ||||||||||| |||||    
18815446 cctttaacggaaccgctttatgccacaaaaaatgatgaaaatcctcagtaatattagggtcaaccgctgttaagtaagaataagcagattgcacggtgta 18815347  T
323 tttgttggaagggtaaagttttcacac--acctatcagccatgtcaac 368  Q
    |||||||||||| | |||||| |||||  |||||||||||||| ||||    
18815346 tttgttggaaggatgaagtttccacaccaacctatcagccatgccaac 18815299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 370
Target Start/End: Complemental strand, 27987821 - 27987471
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| ||||||||| ||| ||||||| ||||||||||||||||  || ||||||||||||||||||||||||| | | | ||||||| |||||||    
27987821 gaactgtatcgatatcaagccaatgggatatcagaagccacaaacgac--tagtgatcacacttaaaaaacaaatggtctttgttctctacagccccaca 27987724  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| | ||||||||| ||||||||||||||||| |||| ||||||  |||| |||||||||| ||||||||||||||||||||||||| |||||||||    
27987723 tgaagccgcacaagataccagtgaaacatccagaatattt-tcttccgtagattatcctttgtagcaagtctattcagaaagagacgccatacaaaaata 27987625  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||| ||| | ||||||| ||||||||||||||||| ||||||||       
27987624 ttaacctttaacggaaccgctttatgccacaaaaaatgatgaaaatcctcagtaatattagtatcaaccgctgttaagtaagaatacgtagattgcaaga 27987525  T
319 tgtatttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    |||||||||||||| ||| |||||| ||||  ||||||||||||||| ||||||    
27987524 tgtatttgttggaatggtgaagtttccacacccacctatcagccatgccaacct 27987471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 24819811 - 24819966
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
24819811 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 24819910  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| || | ||||||||||||||| ||||| ||||| ||||||    
24819911 cagtgatgttagtgtccactgctgttaagtaagaataagcagaatgcaccgtgtat 24819966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 57 - 312
Target Start/End: Original strand, 5196636 - 5196891
57 cacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccagaacat 156  Q
    |||||||||||||| || || ||||||||||| |||||||  || |||||||   | |||||| | | | ||||||| |   | |||||||| || ||||    
5196636 cacaaacgaccgtagtggtcgcacttaaaaaataaatggtccctgtcctctaactcaccacataaggccgcacaagacacatgggaaacatcaagcacat 5196735  T
157 ttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatg 256  Q
     |||||| |||| || |||||||||| |||||||||| |||||||| || |||| ||| ||||| || ||||||||||  || ||| ||||| ||||||     
5196736 atctcttgcacaaattatcctttgtagcaagtctatttagaaagagtcgtcagataaagatattcacttttaacgaaatcgccttaagccac-aaaaatt 5196834  T
257 atgaaaatcctc-agtaatgttattgtcaaccgttgttaagtaagaatacgcagatt 312  Q
    || |||  || | |||||||||| |||||||||| || ||||||||||| |||||||    
5196835 atcaaaccccaccagtaatgttaatgtcaaccgtcgtgaagtaagaataagcagatt 5196891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 40891866 - 40891739
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
40891866 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 40891767  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
40891766 tgttagtgtccaccgctgttaagtaaga 40891739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 323
Target Start/End: Original strand, 12121682 - 12121855
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
12121682 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 12121781  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||| |||||   |||| |||||| | || |||| |||||| |||||||| || || ||||| ||||||    
12121782 aaaattgatcaaaatttgcagtgatgttagtctccaccgctgttaaataagaataagctgaatgcaccgtgtat 12121855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 174 - 298
Target Start/End: Original strand, 586904 - 587028
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| | ||| |||||| ||||  ||||| ||| ||| ||  |||| |    
586904 tcctttgtagcaagtctattcaaaaagagacgccaaacaaaaatattaacctttaagggaaccgctttaagccataaaaaacgatcaaactctgcagtga 587003  T
274 tgttattgtcaaccgttgttaagta 298  Q
    |||||  ||| |||| |||||||||    
587004 tgttagagtcgaccgctgttaagta 587028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 226
Target Start/End: Complemental strand, 20705627 - 20705542
141 gaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    ||||| || ||||| |||||||| | ||||| |||||||||  |||||||||||||||| |||||||| |||||||||||||||||    
20705627 gaaacctcaagaacgtttctcttgcgcagattatcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctt 20705542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 226
Target Start/End: Complemental strand, 20873671 - 20873586
141 gaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    ||||| || ||||| |||||||| | ||||| |||||||||  |||||||||||||||| |||||||| |||||||||||||||||    
20873671 gaaacctcaagaacgtttctcttgcgcagattatcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctt 20873586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 22865847 - 22865783
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
22865847 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 22865783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 47548969 - 47549033
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
47548969 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 47549033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 47553412 - 47553476
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
47553412 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 47553476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 27869019 - 27869076
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaac 230  Q
    |||||||||| ||||||||||||||||||||||||| ||||| || ||||||||||||    
27869019 atcctttgtagcaagtctattcagaaagagacgccaaacaaatatgttaacctttaac 27869076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 168 - 319
Target Start/End: Original strand, 34981961 - 34982112
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||| | |||||||||||| | ||| |||||||||||||||||||| |  || |||||| ||||  |||| |||| ||| ||      
34981961 agattatcctttgtagcaaggcgattcagaaagagcctccaaacaaaaatattaacctttaaagggaccgctttaagccataaaaactgatcaaactctg 34982060  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    || | || ||| | || |||||||||||||||||||| || || ||||||||    
34982061 cattgatattagtatccaccgttgttaagtaagaataagctgaatgcactgt 34982112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 264
Target Start/End: Complemental strand, 36575490 - 36575394
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaat 264  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| |||||    
36575490 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaat 36575394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 168 - 301
Target Start/End: Complemental strand, 37075698 - 37075565
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||| ||||||| | ||| |||||||||||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||      
37075698 agattatcctttgtagcaagtcgattctgaaagagcctccaaacaaaaatattaacttttaaaggaaccgctttaagccataaaaattgatcaaactctg 37075599  T
268 cagtaatgttattgtcaaccgttgttaagtaaga 301  Q
    |||| || ||| | || |||||||||||| ||||    
37075598 cagtgatattagtatccaccgttgttaagaaaga 37075565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 9)
Name: chr1

Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 19 - 370
Target Start/End: Original strand, 26995929 - 26996281
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| | ||||| ||||||||||||||||| || |||||||| || |||||||||| || ||||||||||| |  | ||||    
26995929 gaactgtatcgataccaagccaatgagatatcagaagccacaaacgaccatagtgatcaca-ttgaaaaacaaatagtctctatcctctatagtctcaca 26996027  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |||||||||||   |||| |||||||||||||||||||||  || || |||||||| | |||||||||||||||||||||||||||||||||||    
26996028 tgaagccacacaagatacttgtgagacatccagaacatttctcttctgcaaattatcctttgcaccaagtctattcagaaagagacgccagacaaaaata 26996127  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| ||  ||||| | |||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |    
26996128 ttaacctttaacggaatcgctttcttccacaaaaaatgatgaaaatcctcagtaatattattatcaaccgttgttaagtaagaataagcagattgcacgg 26996227  T
319 tgtatttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    ||||||||||||||||||  ||||| ||||  ||||||||||||||||||||||    
26996228 tgtatttgttggaagggtgtagtttccacacccacctatcagccatgtcaacct 26996281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 23 - 370
Target Start/End: Complemental strand, 24545310 - 24544962
23 tgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaa-caaatggtttctatcctctacacccccacatga 121  Q
    ||||| |||| |||| ||| ||||||| | ||| ||||||||| |||| ||||||||||||||||| |||||||| ||||||||||||| ||||| ||||    
24545310 tgtatcgataccaagccaatgggatatcataaggcacaaacgatcgtagtgatcacacttaaaaaaacaaatggtctctatcctctacagccccaaatga 24545211  T
122 agtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatatta 221  Q
    || | ||||||||| |||||||||||| |||||||||||||| |  |||| |||||||||| ||||||| ||||||||||||||||||||||||||||||    
24545210 agccgcacaagataccagtgaaacatc-agaacatttctctttcgaagattatcctttgtagcaagtctgttcagaaagagacgccagacaaaaatatta 24545112  T
222 acctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgt 321  Q
    || ||||||| |||  ||||||| ||| ||||||||||||| |||||||||| ||||| ||||| || | ||||||||||||||||||||| |||| |||    
24545111 acttttaacggaaccactttatgacac-aaaaatgatgaaattcctcagtaacgttatcgtcaatcgctattaagtaagaatacgcagattacactatgt 24545013  T
322 atttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    ||||||||||||| | |||||| ||||  |||||||||||| || ||||||    
24545012 atttgttggaaggatgaagtttccacacccacctatcagccgtgccaacct 24544962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 40392670 - 40392882
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||||||| | ||||| ||||||||||||| |||||| ||||||||||| ||||||||||||| ||||||||||||| |||||||    
40392670 gaactgtatcgataccaagtcaatgagatatcagaagccacaaacaaccgtagtgatcacacttgaaaaacaaatggtgtctatcctctacagccccaca 40392769  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| | || ||||||   |||||||||||||||||| |||| ||| || ||  |||||| ||  ||||||||| | ||| || |||||||||||||||    
40392770 tgaagccgcataagatacttgtgaaacatccagaacatatctcgtccgcaaattgtcctttatagtaagtctatttaaaaaaagtcgccagacaaaaata 40392869  T
219 ttaacctttaacg 231  Q
40392870 ttaacctttaacg 40392882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 54 - 304
Target Start/End: Complemental strand, 28521059 - 28520809
54 agccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccagaa 153  Q
    |||||||| |||||||| || ||||||||||||||||||||||  || |||||||   | |||||| | ||| ||||||| |  || || ||||| ||||    
28521059 agccacaatcgaccgtagtggtcacacttaaaaaacaaatggtccctgtcctctaactcaccacataaggtcgcacaagacacaagggagacatcaagaa 28520960  T
154 catttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaa 253  Q
    |||| ||| | |||| || ||||| |||| ||||||||||||| ||||||||||| ||||| ||||| |||||||||||||| |||||| ||||| ||||    
28520959 cattcctcatacacaaattatcctctgtagcaagtctattcaggaagagacgccatacaaatatattcacctttaacgaaaccgctttaagccacaaaaa 28520860  T
254 atgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
     |||||||| || ||| | |||||| |||||||| ||||||| ||||||||    
28520859 ttgatgaaactcttcaatgatgttaatgtcaaccattgttaaataagaata 28520809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 10004045 - 10004200
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| ||||||||||||||||||| |||||  |||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
10004045 agattatcctttgtagcaagtctattcagaaagagccgccaagcaaaaatattgacttttaaaggaaccgctttaagccataaaaattgatcaaaatctg 10004144  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| ||||| ||||||    
10004145 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcaccgtgtat 10004200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 27030066 - 27030221
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| ||||||| || |||||||||||| ||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
27030066 agattatcctttatagcaagtctattcaaaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 27030165  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| ||||| ||||||    
27030166 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcaccgtgtat 27030221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 41342910 - 41342783
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
41342910 tcctttgtagcaaatctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactctgcagtga 41342811  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| | || |||| ||||||||||||    
41342810 tgttagtatccaccgctgttaagtaaga 41342783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 37668976 - 37669030
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacg 231  Q
    |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||    
37668976 tttgtatcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacg 37669030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 301
Target Start/End: Original strand, 49369887 - 49370014
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| | |||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
49369887 tcctttgtagcaagtctattcagaaagagacgccaaaaaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 49369986  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    | ||  |||| ||||||||||| |||||    
49369987 tattggtgtccaccgttgttaaataaga 49370014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0289 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: scaffold0289

Target: scaffold0289; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 19 - 370
Target Start/End: Original strand, 11030 - 11382
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| |||| || | |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| | || ||||    
11030 gaactgtatcgataccaagccaatgggagatcaaaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttatgtcctctaaatccacaca 11129  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |||| |||||| ||| || ||||| |||||||||||||||| ||||| ||||||||||  |||||||||||| |||||||  || ||||| |||    
11130 tgaagccacataagataccagggagacatctagaacatttctcttccgcagattatcctttgtagaaagtctattcaggaagagacatcatacaaatata 11229  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| |||  |||| |||||| ||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||| ||||||||||| |    
11230 ttaacctttaacggaacctctttgtgccacaaaaaatgatgaaaatcctcagtaatattagtgtcaactgctgttaagtaagaataagcagattgcacag 11329  T
319 tgtatttgttggaagggtaaagttttcaca-cacctatcagccatgtcaacct 370  Q
    ||||||| || |||||||  ||||| |||| || | |||||||||| ||||||    
11330 tgtatttattcgaagggtggagtttccacaccatccatcagccatgccaacct 11382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 18)
Name: chr4

Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 19 - 333
Target Start/End: Original strand, 24059608 - 24059924
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||    
24059608 gaactgtatcgataccaagccaatgggatatcagaagccacaaacgaccgtagtgatcacacttaaaaaacaaatggtctctatcctctacagccccaca 24059707  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |  |||||||| | |||||||||||||||| | |||| ||| || ||  ||||||||| |||||||| ||| ||||||||| || |||||||||    
24059708 tgaagccgtacaagatacctgtgaaacatccagaacctgtctcgtccgcaaattgtcctttgtagcaagtctactcataaagagacgtcaaacaaaaata 24059807  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattg--cac 316  Q
    ||||| ||||||||||| | ||||||  |   ||||||| ||||||||||| |||| ||||||||||   |||||||||||||||| ||| ||||  |||    
24059808 ttaacttttaacgaaaccgttttatgttatagaaaatgacgaaaatcctcactaatattattgtcaaatattgttaagtaagaataagcatattgtacac 24059907  T
317 tgtgtatttgttggaag 333  Q
24059908 ggtgtatttgttggaag 24059924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 200 - 370
Target Start/End: Original strand, 25135450 - 25135622
200 gagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctca-gtaatgttattgtcaaccgttgttaagta 298  Q
    ||||||| ||||||| |||||||||||||| | ||| |||||| ||||  |||||| ||||||||| | | ||||| ||| ||||||||| |||||| ||    
25135450 gagacgctagacaaatatattaacctttaatggaaccgctttaagccaaaaaaaattatgaaaatcttaaagtaatattagtgtcaaccgctgttaaata 25135549  T
299 agaatacgcagattgcactgtgtatttgttggaagggtaaag-ttttcacacacctatcagccatgtcaacct 370  Q
    |||||| ||||||||||| |||||||||| |||||| | ||| ||  ||| ||||||||||||||| ||||||    
25135550 agaataagcagattgcacggtgtatttgtgggaaggatgaagcttcccacccacctatcagccatgccaacct 25135622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 23158276 - 23158122
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  ||||||||| ||||      
23158276 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaaggggactgctttaagccata 23158177  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| |||||   |||| |||||| |||| |||| |||||||||||||||    
23158176 aaaattgatcaaaatatgcagtgatgttagtgtccaccgctgttaagtaagaata 23158122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 36279329 - 36279175
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||  ||||| |||||||||||||| ||||| | ||| |||||| ||||      
36279329 agaacattcctcttacgaagattatcctttgtagcaagtctattcagaaagaaccgccaaacaaaaatattaacttttaagggaaccgctttaagccata 36279230  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| ||||||  |||| |||||| |||| |||| |||||||||||||||    
36279229 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaata 36279175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 323
Target Start/End: Original strand, 51872781 - 51872954
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
51872781 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 51872880  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||  ||||||  |||| |||||| ||||  ||| |||||| |||||||| || || ||||| ||||||    
51872881 aaaattgaacaaaatctgcagtgatgttagtgtctgccgctgttaaataagaataagctgaatgcaccgtgtat 51872954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 8111038 - 8111111
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||  ||||||||||||||||||||||||| |||||||||||||||||||| | ||| |||||| ||||    
8111038 tcctttgttgcaagtctattcagaaagagacgccatacaaaaatattaacctttaatggaaccgctttaagcca 8111111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 319
Target Start/End: Complemental strand, 17826883 - 17826738
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| |||||  ||||| ||||  |||| |||| ||| ||  |||| |    
17826883 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaaggaaaccactttaagccataaaaattgatcaaactctacagtga 17826784  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    | ||  |||| ||||||||||| ||||| || || || ||||||||    
17826783 tattgatgtccaccgttgttaaataagagtaagctgaatgcactgt 17826738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 168 - 319
Target Start/End: Complemental strand, 15649175 - 15649024
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||| | |||||||||||| | ||| |||||||||||||||||||| |  ||||||||| ||||  | ||||||| ||| ||      
15649175 agattatcctttgtagcaaggcgattcagaaagagcctccaaacaaaaatattaacctttaaagggactgctttaagccataataaatgatcaaactctg 15649076  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    || | || ||| | || |||||||||||||||||||| || || ||||||||    
15649075 cattgatattagtatccaccgttgttaagtaagaataagctgaatgcactgt 15649024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 18116484 - 18116357
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
18116484 tcctttgtagcaaatctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactctgcagtga 18116385  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| | || |||| ||||||||||||    
18116384 tgttagtatccaccgctgttaagtaaga 18116357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 304
Target Start/End: Complemental strand, 29123541 - 29123410
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa-cgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| |||||  ||||| |||||| ||||  |||| |||| ||| ||  ||||     
29123541 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaaccgctttaagccataaaaattgatcaaactctgcagtg 29123442  T
273 atgttattgtcaaccgttgttaagtaagaata 304  Q
    || ||  |||| ||||||||||| ||||||||    
29123441 atattgatgtccaccgttgttaaataagaata 29123410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 174 - 247
Target Start/End: Complemental strand, 4303304 - 4303231
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| |||||||||||||||| |||||||| |||||||||||||| ||||| | ||| |||||| ||||    
4303304 tcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatattaacttttaagggaaccgctttaagcca 4303231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 12915913 - 12915985
176 ctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccac 248  Q
    ||||||| ||| ||||||||||||||||||||| |||||||| ||||||||||||| ||| || ||| |||||    
12915913 ctttgtagcaattctattcagaaagagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccac 12915985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 36951324 - 36951388
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
36951324 tttgtagcaagtctattcagaaagagacgccatacaaaaatgttaaccttcaacggaaccgcttt 36951388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 50693853 - 50693789
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
50693853 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 50693789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 3621622 - 3621677
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||  |||||||||||||||| |||||||| ||||||||||||||||||||    
3621622 tcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctttaa 3621677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 22340699 - 22340829
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||| |||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| |||  |  |||| |    
22340699 tcctttgtagcaagtctatttagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaacactgcagtga 22340798  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    | ||  |||| ||||||||||| ||||||||    
22340799 tattgatgtccaccgttgttaaataagaata 22340829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 53 - 182
Target Start/End: Original strand, 25135278 - 25135407
53 aagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccaga 152  Q
    ||||||||| |||||  | ||||| ||||||||||||||||||| | | |||||||   ||||||| |||| | |||||||    || || |||||||||    
25135278 aagccacaatcgaccaaagtgatcgcacttaaaaaacaaatggtctttgtcctctaataccccacaagaagccgcacaagaagctagggagacatccaga 25135377  T
153 acatttctcttccacagataatcctttgta 182  Q
    ||||||||||||| || || ||||||||||    
25135378 acatttctcttccgcaaattatcctttgta 25135407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 17469223 - 17469159
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| |||||||||||||||||||| |||| |||||||| |||||||| |||| ||| |||||    
17469223 tttgtagcaagtctattcagaaagagatgccaaacaaaaatgttaaccttcaacggaaccgcttt 17469159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 6)
Name: chr6

Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 174 - 316
Target Start/End: Original strand, 17228056 - 17228198
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||| |||||||||||||||||||| || || || ||||||| |||||||||| ||||| ||||||||||||| || ||||| |    
17228056 tcctttgtagcaagtctatttagaaagagacgccagacaaatatgttcacatttaacggaactgctttaagccacaaaaaatgatgaaactcttcagtga 17228155  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    | ||| ||||||||| |||||| ||||||||||| ||||||||    
17228156 ttttagtgtcaaccgctgttaaataagaatacgccgattgcac 17228198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 2894351 - 2894506
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| |||||||||||||| ||||| | ||| |||||| ||||   ||| |||| ||||||      
2894351 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattaacttttaagggaaccgctttaagccatagaaattgatcaaaatctg 2894450  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| | || |||| ||||||||||||||| ||||| ||||| ||||||    
2894451 cagtgatgttagtatccaccgctgttaagtaagaataagcagaatgcaccgtgtat 2894506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 173 - 265
Target Start/End: Complemental strand, 7218453 - 7218361
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatc 265  Q
    |||||||||| |||||||||||||||| |||||||| |||||||| ||||||||||||| ||| || ||| ||||  |||| |||||||||||    
7218453 atcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccataaaaattgatgaaaatc 7218361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 18295522 - 18295368
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
18295522 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 18295423  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| |||||   |||| |||||| | || |||| |||||| ||||||||    
18295422 aaaattgatcaaaatatgcagtgatgttagtatccaccgctgttaaataagaata 18295368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 319
Target Start/End: Original strand, 667385 - 667530
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| | |||  ||||| ||||  |||| |||| ||| ||  |||| |    
667385 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacctttaagggaaccactttaagccataaaaattgattaaactctgcagtga 667484  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    ||||  |||| |||| |||||| ||||| || || || ||||||||    
667485 tgttgatgtccaccgctgttaaataagagtaagctgaatgcactgt 667530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 28604989 - 28604934
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||  |||||||||||||||| |||||||| ||||||||||||||||||||    
28604989 tcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctttaa 28604934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 9)
Name: chr2

Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 20007463 - 20007602
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctaca-cccccac 117  Q
    ||||| ||| |||| |||| ||| ||||||| ||||||||||||| |||||| ||||||||||| ||||||||||||| |||||||||||||   |||||    
20007463 gaactatatcgataccaagccaatgggatatcagaagccacaaacaaccgtagtgatcacactt-aaaaacaaatggtctctatcctctacagaacccac 20007561  T
118 atgaagtcacacaagatatcagtgaaacatccagaacattt 158  Q
    ||||||  |||||||||| | |||||||||| |||||||||    
20007562 atgaagctacacaagatacctgtgaaacatctagaacattt 20007602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 304
Target Start/End: Original strand, 30275985 - 30276139
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| | ||||||||||||||||| | ||| |||||||||||||| ||||| | ||| |||||| ||||      
30275985 agaacattcctcttgcgaagattatcctttgtagcgagtctattcagaaagagcctccaaacaaaaatattaacttttaagggaaccgctttaagccata 30276084  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| ||||||  |||| |||||| |||| |||| |||||||||||||||    
30276085 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaata 30276139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 316
Target Start/End: Original strand, 1258561 - 1258723
154 catttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaa 253  Q
    ||||||| || |||| || ||| |||||| ||||||||||||||||||||||| | ||||| || |||||||| |||| ||| |||||   |||  ||||    
1258561 catttcttttacacaaattatcttttgtagcaagtctattcagaaagagacgcaaaacaaatatgttaaccttcaacggaaccgcttttaaccataaaaa 1258660  T
254 atgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
     |||| |||||| |||| ||||||| |||| ||||  |||||||| ||||| || ||||||||    
1258661 ttgattaaaatcttcagaaatgttagtgtccaccgccgttaagtacgaataagccgattgcac 1258723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 23384957 - 23385093
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| || |||||||||||||||| ||||| |||||||||||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||      
23384957 agattatcctttgtagcatgtctattcagaaagagccgccaaacaaaaatattaacttttaaaggaaccgctttaagccataaaaattgatcaaactctg 23385056  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| || ||| | || |||  |||||||||||||||    
23385057 cagtgatattagtatccaccactgttaagtaagaata 23385093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 173 - 304
Target Start/End: Original strand, 32349993 - 32350124
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    |||||||||| ||||||||||||||||||| | | | |||||||||||||| ||||| | ||  |||||| ||||  |||| |||| ||||||  ||||     
32349993 atcctttgtagcaagtctattcagaaagagccacgaaacaaaaatattaacttttaagggaatcgctttaagccataaaaattgatcaaaatctgcagtg 32350092  T
273 atgttattgtcaaccgttgttaagtaagaata 304  Q
    || ||| | || |||| |||||||||||||||    
32350093 atattagtatccaccgctgttaagtaagaata 32350124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 21963522 - 21963658
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
21963522 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 21963621  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
21963622 cagtgagattagtatccaccgttgttaagtaagaata 21963658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 21964707 - 21964843
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
21964707 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 21964806  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
21964807 cagtgagattagtatccaccgttgttaagtaagaata 21964843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 38938592 - 38938665
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    |||||||||  |||||||||||||||||||||||| |||||||| ||||  ||||| | ||| |||||| ||||    
38938592 tcctttgtagtaagtctattcagaaagagacgccaaacaaaaatgttaatttttaagggaaccgctttaagcca 38938665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 168 - 223
Target Start/End: Complemental strand, 27914709 - 27914654
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaac 223  Q
    |||| |||||||||| ||||||||||||||||||  || || ||||||||||||||    
27914709 agattatcctttgtagcaagtctattcagaaagaaccgtcaaacaaaaatattaac 27914654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 14)
Name: chr3

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 150 - 322
Target Start/End: Original strand, 3514780 - 3514952
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||  ||||| |||||||||||||| ||||| |  || |||||| ||||      
3514780 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagaaccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 3514879  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    |||| |||| ||||||  |||| |||||| |||| |||| ||||||||||||||| || || ||||| |||||    
3514880 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaataagctgaatgcaccgtgta 3514952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 174 - 322
Target Start/End: Original strand, 48547674 - 48547822
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||  |||| |||| ||| ||  |||| |    
48547674 tcctttgttgcaagtctattcagaaagagacgccagacaaaaatattaacctttaatggaactgctttaagccataaaaattgattaaactctgcagtga 48547773  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||   ||| ||||| ||||| |||||||| || || ||||| |||||    
48547774 tgttgaagtccaccgtcgttaaataagaataagctgaatgcaccgtgta 48547822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 168 - 316
Target Start/End: Original strand, 9819174 - 9819322
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||| ||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
9819174 agattatcctttgtagcaagtctattcagaaaaagccgccaaacataaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 9819273  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| |||||    
9819274 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcac 9819322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 23603382 - 23603512
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||| ||| ||||||||||||||||||| ||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||| || | |    
23603382 tccttagtagcaagtctattcagaaagagtcgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactccgcaatga 23603481  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    | |||||||| ||||||||||||||||||||    
23603482 tattattgtccaccgttgttaagtaagaata 23603512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 23571723 - 23571596
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||||||||||||| || |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
23571723 tcctttgtagcaagtctattcagaaagagacgtcatacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctacagtga 23571624  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
23571623 tgttagtgtccaccgctgttaagtaaga 23571596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 42462840 - 42462970
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||||||||| |||||| |||||||| ||||| ||||| | | | | |||| ||||  |||| |||| ||| ||  ||||||    
42462840 tcctttgtagcaagtctattcagaaagaaacgccaaacaaaaatgttaacttttaagggagccgttttaagccataaaaattgatcaaactctgcagtaa 42462939  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    ||||  |||| ||||||||||| ||||||||    
42462940 tgttgatgtccaccgttgttaaataagaata 42462970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 8595377 - 8595450
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||    
8595377 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagcca 8595450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 16664099 - 16664163
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
16664099 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 16664163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 39632931 - 39632867
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
39632931 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 39632867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 10754162 - 10754250
153 acatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||||| || |||| || ||| |||||| |||||||||||| |||||||||||| ||||| || |||||||| |||| ||| |||||    
10754162 acatttcttttacacaaattatcttttgtagcaagtctattcataaagagacgccaaacaaagatgttaaccttcaacggaaccgcttt 10754250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 52196409 - 52196473
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||| ||||| |||||||| |||||||| |||| ||| |||||    
52196409 tttgtagcaagtctattcagaaagaggcgccaaacaaaaatgttaaccttcaacggaaccgcttt 52196473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 168 - 247
Target Start/End: Complemental strand, 17153915 - 17153836
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    |||| |||||||||| |||||||||||| |||||| ||||| | |||||||||||| ||||| | ||| |||||| ||||    
17153915 agattatcctttgtagcaagtctattcataaagagccgccaaataaaaatattaacttttaatggaaccgctttaagcca 17153836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 42459405 - 42459278
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| |||||||||||| ||||| || |||||||| ||||||||||||| |||  | ||| ||||  | || || | |||||| ||||| |    
42459405 tcctttgtagcaattctattcagaaaaagacgtcaaacaaaaatgttaacctttaacggaacctccttaagccataagaattggttaaaatcttcagtga 42459306  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    |||| ||||| |||| |||||| |||||    
42459305 tgttgttgtccaccgctgttaaataaga 42459278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 229
Target Start/End: Complemental strand, 53152193 - 53152132
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    |||| |||||||||| |||||| |||| ||||||| | ||| |||||||||||||| |||||    
53152193 agattatcctttgtagcaagtcgattctgaaagagcctccaaacaaaaatattaacttttaa 53152132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 3e-21; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 174 - 322
Target Start/End: Complemental strand, 26077828 - 26077680
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||||||  |||| |    
26077828 tcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccataaaaattgatcaaaatctgcagtga 26077729  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||| |||| |||| ||||||| ||||||| || || ||||| |||||    
26077728 tgttagtgtccaccgctgttaagaaagaataagctgaatgcaccgtgta 26077680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 153 - 241
Target Start/End: Complemental strand, 10801803 - 10801715
153 acatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||||| || |||| || ||| |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
10801803 acatttcttttacacaaattatcttttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 10801715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 184 - 322
Target Start/End: Complemental strand, 31423333 - 31423195
184 caagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtc 283  Q
    |||||||||||||||||||||| ||||||||||||||||||||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |||||   | |    
31423333 caagtctattcagaaagagacgtcagacaaaaatattaacctttaagggaaccgctttaagccataaaaattgattaaactctgcagtgatgttgaagcc 31423234  T
284 aaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
     ||||||||||| |||||||| || || ||||| |||||    
31423233 caccgttgttaaataagaataagctgaatgcaccgtgta 31423195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 178 - 229
Target Start/End: Complemental strand, 26390340 - 26390289
178 ttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||||||||    
26390340 ttgtagcaagtctattcagaaagagacgccagacaaaaatgttaacctttaa 26390289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 29532477 - 29532532
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||    
29532477 tcctttgtagcaagtctattcagaaagagacgccagacaaaaatgttaacatttaa 29532532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0041

Target: scaffold0041; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 174 - 301
Target Start/End: Original strand, 74418 - 74545
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
74418 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 74517  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
74518 tgttagtgtccaccgctgttaagtaaga 74545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0032

Target: scaffold0032; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 304
Target Start/End: Complemental strand, 58498 - 58368
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
58498 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacctttaagggaaccgctttaagccataaaaattgattaaactctgcagtga 58399  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    ||||  |||| |||| |||||| ||||||||    
58398 tgttgatgtccaccgctgttaaataagaata 58368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0003

Target: scaffold0003; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 265
Target Start/End: Complemental strand, 224828 - 224737
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatc 265  Q
    ||||||||| |||||||||||||||| |||||||| |||||||| ||||||||||||| ||| || ||| ||||  |||| |||||||||||    
224828 tcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccataaaaattgatgaaaatc 224737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 9)
Name: chr5

Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 11266145 - 11266218
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||| | ||| |||||| ||||    
11266145 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatattaacttttaaaggaaccgctttaagcca 11266218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 27891818 - 27891891
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||  |||||||||||||||||||| ||||||||||||||||||||||||| | ||| |||||| ||||    
27891818 tcctttgttgcaagtctattcagaaagagatgccagacaaaaatattaacctttaatggaaccgctttaagcca 27891891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 29322916 - 29322980
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
29322916 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 29322980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 29150424 - 29150481
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacg 231  Q
    ||||||||| ||||||||||||| || |||| ||| ||||||||||||||||||||||    
29150424 tcctttgtagcaagtctattcaggaaaagacaccaaacaaaaatattaacctttaacg 29150481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Complemental strand, 5825077 - 5824941
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
5825077 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 5824978  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
5824977 cagtgagattagtatccaccgttgttaagtaagaata 5824941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 173 - 316
Target Start/End: Complemental strand, 31962775 - 31962632
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    |||||||||| |||||||||||||| ||||| |||| ||||| || ||||||||||||| |||  ||||  ||||  |||| |||  |||||| ||||      
31962775 atcctttgtagcaagtctattcagatagagatgccaaacaaatatgttaacctttaacggaaccacttttagccataaaaattgagcaaaatcttcagag 31962676  T
273 atgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    |||||| |||| || |  ||||| |||||||| || ||||||||    
31962675 atgttagtgtccactgccgttaaataagaataagctgattgcac 31962632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 8896369 - 8896418
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    |||||| ||||||||||||||||||||||||| ||||  || ||||||||    
8896369 tttgtagcaagtctattcagaaagagacgccaaacaactatgttaacctt 8896418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 38931892 - 38931941
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    |||||| |||||||||||||||||||| |||| ||||| || ||||||||    
38931892 tttgtagcaagtctattcagaaagagatgccaaacaaatatgttaacctt 38931941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 6678684 - 6678632
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatatt 220  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||    
6678684 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatatt 6678632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137317 times since January 2019
Visitors: 1446