View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_7 (Length: 387)

Name: NF1565_high_7
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_high_7
[»] chr7 (2 HSPs)
chr7 (1-363)||(33777163-33777525)
chr7 (3-301)||(33774587-33774888)
[»] chr8 (7 HSPs)
chr8 (1-344)||(10657513-10657853)
chr8 (18-327)||(10707449-10707755)
chr8 (90-342)||(10634024-10634273)
chr8 (1-264)||(10693636-10693896)
chr8 (18-280)||(10698240-10698499)
chr8 (1-278)||(10690290-10690564)
chr8 (250-343)||(10693909-10694002)
[»] chr2 (2 HSPs)
chr2 (1-278)||(15240269-15240546)
chr2 (1-264)||(15246621-15246877)

Alignment Details
Target: chr7 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 33777525 - 33777163
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
33777525 ccccaattgtttggaaggaacattaacaccaaagaaactattgaaagtgaaccaaacacttctatgagtgtatcaattcttgttgtggtaaacttaatct 33777426  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
33777425 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 33777326  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 300  Q
33777325 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 33777226  T
301 atattgattgtcacttcatgaccttgattaaaactggatcttggtctcataacactagccatg 363  Q
33777225 atattgattgtcacttcatgaccttgattaaaactggatcttggtctcataacactagccatg 33777163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 301
Target Start/End: Complemental strand, 33774888 - 33774587
3 ccaattgtttgggaggaacatc----aacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaat 98  Q
    ||||||||||||||||||||||    ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||    
33774888 ccaattgtttgggaggaacatcgatcaacaccaaagaaactattgaaagtgagccaaacacttccatgagtgtatcaattcttgtcgtggtaaacttaat 33774789  T
99 cttaatccaaaagaccaaacaatatagtagaaa-gctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataact 197  Q
     |||||||| |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33774788 attaatccagaagaccaagcaatatagtagaaaagctagcaatagtgacaaacattgtctttggatggacatgaaatgcagtgggattatctggataact 33774689  T
198 aatttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactc 297  Q
    |||||||||||||||||||||| |  ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||     
33774688 aatttgaaggaaaccaatgagtcc--agaaaatgaaggccataaggccatgaaaatgattggtttctactcccatgatgttataaacattaactacacta 33774591  T
298 acaa 301  Q
33774590 acaa 33774587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 7)
Name: chr8

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 10657513 - 10657853
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    ||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||| |||||||||| ||||||| |||| | |    |||||||| ||    
10657513 ccccatttgtttgggatgaacatcaacaccaaagaaattattgaaagtgaaccaaacgcttccatgagggtatcaagtcttatagc---aaacttaagct 10657609  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||||||||||| | || |||||||||||||||||||| | |||||  | |||||||||||||||| | ||||||||||||||||||| ||||||||||||    
10657610 taatccaaaaggcaaagcaatatagtagaaagctagctacagagagtagcattgtctttggatgggcttgaaatgcagtgggattatttggataactaat 10657709  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 300  Q
    |||||||||||||||||| |||||||||| ||||| |||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||  ||    
10657710 ttgaaggaaaccaatgaggacaaagaaaaggaaggtcataaggccatggagaggattggtttctactcccatgatgttataaacattaacaacactggca 10657809  T
301 atattgattgtcacttcatgaccttgattaaaactggatcttgg 344  Q
    | ||| || ||||| |||||||||||||||||| ||||||||||    
10657810 acatttatggtcacctcatgaccttgattaaaagtggatcttgg 10657853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 18 - 327
Target Start/End: Original strand, 10707449 - 10707755
18 gaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatcttaatccaaaagaccaaa 117  Q
    |||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||  |||||||    |||| ||| ||||||||||||| | |||    
10707449 gaacatcaacaccaaagaaactattgaaagggaaccaaacacttccatgagggtatcaacccttgttgc---aaacataagcttaatccaaaaggcaaaa 10707545  T
118 caatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaatttgaaggaaaccaatga 217  Q
    |||||||||||||||||||||| |||||  | |||||| ||||||||||  ||||||||||||||||||||||||||| ||||||| |||||| ||| ||    
10707546 caatatagtagaaagctagcaacagagattatcattgtttttggatggatttgaaatgcagtgggattatctggataagtaatttggaggaaagcaagga 10707645  T
218 gtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcacaatattgattgtcacttc 317  Q
    ||||||||||||||||||||||||||| ||| | ||| ||||||||||| ||||||||||| ||||||||||||||||| |||| ||| || ||||||||    
10707646 gtacaaagaaaatgaaggccataaggctatgtagagggttggtttctactcccatgatgttgtaaacattaacaacacttacaacatttatggtcacttc 10707745  T
318 atgaccttga 327  Q
    ||||| ||||    
10707746 atgactttga 10707755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 90 - 342
Target Start/End: Original strand, 10634024 - 10634273
90 aaacttaatcttaatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatct 189  Q
    |||||||||||||||||||||| |||| |||||||||| ||| ||||| ||||||||||||||||||||||||||||| | ||| |  || ||||| |||    
10634024 aaacttaatcttaatccaaaaggccaagcaatatagtaaaaaactagccatagagacaaacattgtctttggatggacttcaaacgaggttggattttct 10634123  T
190 ggataactaatttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaa 289  Q
    ||||| | |||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||| ||| || ||| || ||||||||    
10634124 ggatatcgaatttggaggaaaccaatgagtacaaaaaaaatgaaggccataaggacatgaaaaggattgttttctactcccttggtgtcatgaacattaa 10634223  T
290 caacactcacaatattgattgtcacttcatgaccttgattaaaactggatctt 342  Q
    |||| |   | ||||||||||||||||||  ||||||||||||||| ||||||    
10634224 caactc---ctatattgattgtcacttcagaaccttgattaaaacttgatctt 10634273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 10693636 - 10693896
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||| ||||| |||||||| ||||||| ||||||||||||| |||||||||||||||||||  |||||||  || ||||    |||||| | ||    
10693636 ccccaattgtgtgggaagaacatcatcaccaaagaaactattgaaagggaaccaaacacttccatgaaggtatcaaccctagttgc---aaacttgagct 10693732  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||||||||||| | ||  |||||| |||||||||||||| |||||  | |||||||||||||||||  ||||||||| |||| |||||||||||||| ||    
10693733 taatccaaaaggcaaaggaatatattagaaagctagcaacagagagtatcattgtctttggatggatttgaaatgcactgggtttatctggataactgat 10693832  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttct 264  Q
    ||| |||||||||| ||||||||||||| ||||||||||||| | ||||| |||||||||||||    
10693833 ttggaggaaaccaaggagtacaaagaaagtgaaggccataagacaatgaagaggattggtttct 10693896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 10698240 - 10698499
18 gaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatcttaatccaaaagaccaaa 117  Q
    |||||||||||||||| ||| ||||||||| |||||||||||||||||||| |||||||  ||||||||   |||||||| ||||||||||||| |||||    
10698240 gaacatcaacaccaaagaaattattgaaagggaaccaaacacttccatgagggtatcaacccttgttgt---aaacttaagcttaatccaaaaggccaaa 10698336  T
118 caatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaatttgaaggaaaccaatga 217  Q
    |||||||| ||||| ||||||||||| || ||| || ||||||||||||  |||||||  || ||||| ||||| || |||||||| |||||||||| ||    
10698337 caatataggagaaaactagcaatagacactaacgttatctttggatggatttgaaatggggtaggattttctgggtatctaatttggaggaaaccaagga 10698436  T
218 gtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttat 280  Q
    ||||||||||||| ||||| | |||||||||   |||||| ||||| |  |||||||||||||    
10698437 gtacaaagaaaataaaggctacaaggccatgttgaggattagtttccattcccatgatgttat 10698499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 10690290 - 10690564
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||| | |||||| ||||||||||||||  ||| || |||||||||||||||||||||||  |  |||||||  ||||| |    |||||||| ||    
10690290 ccccaattttctgggagcaacatcaacaccaatgaaattaatgaaagtgaaccaaacacttccaacaaggtatcaacccttgtagc---aaacttaagct 10690386  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    |||||   ||| |||| |||||||||||||||||||||||||| || ||| |||||||||||||||| ||||| |  || ||||| |||||||| ||||     
10690387 taatcatgaaggccaagcaatatagtagaaagctagcaatagataccaacgttgtctttggatggacttgaaaaggggtaggattttctggatatctaac 10690486  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgtt 278  Q
    ||| |||||||||| ||||||||||||||||||||| | |||||||||   |||||| |||||||| |||||||||||    
10690487 ttggaggaaaccaaggagtacaaagaaaatgaaggctacaaggccatgttgaggattagtttctactcccatgatgtt 10690564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 250 - 343
Target Start/End: Original strand, 10693909 - 10694002
250 aaaggattggtttctaca---cccatgatgttataaacattaacaacactcacaatattgattgtcacttcatgaccttgattaaaactggatcttg 343  Q
    |||||||||||||||||    ||||||||||||||||||||||||   ||||||| ||| || ||||||||||||| | |||||||| |||||||||    
10693909 aaaggattggtttctactactcccatgatgttataaacattaaca---ctcacaacatttatggtcacttcatgacttcgattaaaattggatcttg 10694002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 15240546 - 15240269
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||| ||||| ||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |||||||| ||||||||   ||| ||||  |    
15240546 ccccaattgtgtgggaagaacatcaaaaccaaagaaattattgaaagggaaccaaacacttccatgagggtatcaatccttgttgtatcaaatttaagtt 15240447  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||| ||||||  | ||| |||||||||||||||||||||||||||| |||||||||||||||||||  |||||  | |||||||||||||||||||  ||    
15240446 taacccaaaatgctaaagaatatagtagaaagctagcaatagagactaacattgtctttggatggagttgaaagactgtgggattatctggataacagat 15240347  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgtt 278  Q
    ||| || ||||| || || ||| | ||||||||||||| ||| ||||||| || ||||||| |||  |||||||||||    
15240346 ttggagaaaacctataagcacataaaaaatgaaggccacaagaccatgaagagaattggttgctattcccatgatgtt 15240269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 15246877 - 15246621
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||| ||||||| |||||||||||||||| ||| ||||||||| ||||||||||||||| | || |||||||  ||| |   || ||| ||||  |    
15246877 ccccaattctttgggaagaacatcaacaccaaagaaattattgaaagcgaaccaaacacttccttaagggtatcaagccttct---ggcaaatttaagtt 15246781  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||| || |||  |||||||||||||||||||||||||||||||||| |||||||||||||||| |   ||||| |  ||||||||||||||||| |||||    
15246780 taaccctaaaagccaaacaatatagtagaaagctagcaatagagactaacattgtctttggattg--ttgaaaggttgtgggattatctggatagctaat 15246683  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttct 264  Q
    | |  |||||||  |||||||| | ||||  ||||||| | ||||||||| |||||||||||||    
15246682 tcg--ggaaacctctgagtacacaaaaaaataaggccacagggccatgaagaggattggtttct 15246621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149587 times since January 2019
Visitors: 1516