View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_8 (Length: 384)

Name: NF1565_high_8
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_8
NF1565_high_8
[»] chr8 (5 HSPs)
chr8 (17-251)||(38865761-38865995)
chr8 (301-375)||(38866040-38866114)
chr8 (107-187)||(38841834-38841906)
chr8 (29-94)||(38862383-38862444)
chr8 (128-173)||(38850285-38850329)


Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 38865761 - 38865995
Alignment:
17 ttaagtacaatcttcatgcaagtggttatatcgcaatatatatgtttggtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgaca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865761 ttaagtacaatcttcatgcaagtggttatatcgcaatatatatgttttgtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgaca 38865860  T
117 acaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaatctaagtaatactatttgtctacagctata 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865861 acaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaatctaagtaatactatttgtctacagctata 38865960  T
217 cgtacttttgtgcggaaaaagtgcttgtgcttgtg 251  Q
    |||||||||||||||||||||||||||||||||||    
38865961 cgtacttttgtgcggaaaaagtgcttgtgcttgtg 38865995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 301 - 375
Target Start/End: Original strand, 38866040 - 38866114
Alignment:
301 agcttcttggcaatttggatgaagtagtagggcacatcgtgaattagtatagtaaccacggaagacaagaattat 375  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
38866040 agcttcttggcaatttggatgaagtagtagggcacatagtgaattagtatagtaaccacggaagacaagaattat 38866114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 107 - 187
Target Start/End: Original strand, 38841834 - 38841906
Alignment:
107 gtaaatgacaacaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaat 187  Q
    ||||||||||||||||||||    |||||||||||||||||||||    |||||||||||||||||||||| |||| ||||    
38841834 gtaaatgacaacaattgatc----aaattgacaaaatgtttaagc----taaatttgatctgcaatctaatataatttaat 38841906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 94
Target Start/End: Original strand, 38862383 - 38862444
Alignment:
29 ttcatgcaagtggttatatcgcaatatatatgtttggtttaagaagacgtggttcctaattaaagc 94  Q
    |||||||||||||||| |||| |||||||    ||||||||||||| ||||| |||||||||||||    
38862383 ttcatgcaagtggttagatcgtaatatat----ttggtttaagaagtcgtggctcctaattaaagc 38862444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 173
Target Start/End: Complemental strand, 38850329 - 38850285
Alignment:
128 atcaaattgacaaaatgtttaagctaattaaatttgatctgcaatc 173  Q
    ||||||||| ||||||||||||||||||| |||||||| |||||||    
38850329 atcaaattggcaaaatgtttaagctaatt-aatttgatatgcaatc 38850285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142227 times since January 2019
Visitors: 1479