View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_high_9 (Length: 369)

Name: NF1565_high_9
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_high_9
NF1565_high_9
[»] chr1 (1 HSPs)
chr1 (1-353)||(52238932-52239283)


Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 52238932 - 52239283
Alignment:
1 tggatccaattaagaaatattatgtcatatttttgtaaataaattttgaaagaattaattttacttagaggattagcagtattcatcaaaactaaaatac 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52238932 tggatccaattatgaaatattatgtcatatttttgtaaataaattttgaaagaattaattttacttagaggattagcagtattcatcaaaactaaaatac 52239031  T
101 atatcaagaattctcctatgtaacaaacggatccatacacaaagaagatacgtagaaaattaatcacgtaattaaacctaaatggcaaatgagtttgata 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
52239032 atatcaagaattctcctatgtaacaaacggatccatacacaaagaagatacgtagaaaattaatcatgtaattaaacctaaatggcaaatgagtttgata 52239131  T
201 aagctttacttaaaaaattgactatatttttgttaaaatcaattagagaattacgtgtagaagcaacaaacacacatgcacaaaactaaatgaaacgaat 300  Q
    || |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||    
52239132 aaactttacttaaaaaattgactatatttctgttaaaatcaattagagaataacgtgtagaagcaacaaacacacatgcacaaaact-aatgaaacgaat 52239230  T
301 agtcttgcacctacagacacggggttaagtaaaagcattaatttcttagatat 353  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52239231 agtcttgcacctacagacacggggttaagtaaaagcattaatttcttagatat 52239283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142128 times since January 2019
Visitors: 1479