View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_1 (Length: 764)

Name: NF1565_low_1
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_1
NF1565_low_1
[»] chr5 (11 HSPs)
chr5 (162-462)||(9411194-9411493)
chr5 (494-752)||(30624865-30625123)
chr5 (494-752)||(41413401-41413659)
chr5 (221-398)||(14270716-14270893)
chr5 (494-752)||(1828413-1828671)
chr5 (494-752)||(40313878-40314136)
chr5 (1-159)||(9424145-9424303)
chr5 (531-708)||(31482071-31482248)
chr5 (634-736)||(24788298-24788400)
chr5 (314-387)||(1278223-1278296)
chr5 (634-701)||(39884696-39884763)
[»] chr4 (16 HSPs)
chr4 (494-752)||(27292947-27293205)
chr4 (494-752)||(4919016-4919273)
chr4 (494-736)||(42976332-42976573)
chr4 (220-400)||(54676943-54677121)
chr4 (644-711)||(45989609-45989676)
chr4 (634-711)||(20133410-20133487)
chr4 (644-736)||(42069020-42069112)
chr4 (634-736)||(55919361-55919463)
chr4 (644-711)||(47031458-47031525)
chr4 (222-362)||(34114776-34114921)
chr4 (634-705)||(15531216-15531287)
chr4 (634-736)||(28679508-28679610)
chr4 (217-397)||(48351638-48351822)
chr4 (220-329)||(9595018-9595127)
chr4 (494-581)||(24228273-24228360)
chr4 (222-252)||(17643733-17643763)
[»] chr3 (14 HSPs)
chr3 (494-752)||(50650350-50650608)
chr3 (494-752)||(12938402-12938660)
chr3 (514-736)||(31658794-31659015)
chr3 (524-708)||(33216657-33216841)
chr3 (529-701)||(29833311-29833483)
chr3 (221-361)||(34387435-34387573)
chr3 (634-711)||(39833230-39833307)
chr3 (279-353)||(1292228-1292301)
chr3 (274-378)||(1294763-1294865)
chr3 (634-705)||(29703541-29703612)
chr3 (634-705)||(36950163-36950234)
chr3 (634-732)||(5232946-5233044)
chr3 (634-732)||(20104322-20104420)
chr3 (634-705)||(53282294-53282365)
[»] chr1 (9 HSPs)
chr1 (494-751)||(27286165-27286422)
chr1 (494-752)||(52385772-52386030)
chr1 (223-399)||(27528170-27528347)
chr1 (221-387)||(32800554-32800723)
chr1 (494-711)||(39241559-39241773)
chr1 (221-399)||(34105859-34106039)
chr1 (634-736)||(12981521-12981623)
chr1 (634-736)||(45348242-45348344)
chr1 (644-710)||(45325635-45325701)
[»] chr7 (10 HSPs)
chr7 (498-752)||(19436677-19436931)
chr7 (494-752)||(29833903-29834161)
chr7 (494-662)||(29258388-29258556)
chr7 (634-736)||(45972423-45972525)
chr7 (644-711)||(6442636-6442703)
chr7 (645-711)||(34094118-34094184)
chr7 (634-711)||(29243380-29243455)
chr7 (634-732)||(47327942-47328040)
chr7 (223-291)||(20439260-20439328)
chr7 (221-342)||(34974809-34974926)
[»] chr2 (16 HSPs)
chr2 (494-752)||(14096257-14096515)
chr2 (221-399)||(15819792-15819968)
chr2 (222-396)||(34311952-34312127)
chr2 (242-360)||(41696567-41696685)
chr2 (621-736)||(18977085-18977200)
chr2 (634-736)||(14810089-14810191)
chr2 (634-736)||(15330735-15330837)
chr2 (221-397)||(36922526-36922716)
chr2 (634-736)||(37261671-37261773)
chr2 (634-736)||(16429864-16429966)
chr2 (634-736)||(17690604-17690706)
chr2 (494-580)||(18977216-18977302)
chr2 (634-732)||(37078947-37079045)
chr2 (634-687)||(7089225-7089278)
chr2 (634-705)||(33755075-33755146)
chr2 (347-388)||(41696508-41696549)
[»] chr6 (4 HSPs)
chr6 (494-752)||(12938643-12938901)
chr6 (514-752)||(33694802-33695039)
chr6 (532-711)||(28138039-28138217)
chr6 (604-668)||(14532051-14532115)
[»] chr8 (9 HSPs)
chr8 (218-399)||(29308672-29308853)
chr8 (220-378)||(10309158-10309316)
chr8 (521-708)||(13802682-13802869)
chr8 (584-708)||(23613574-23613699)
chr8 (642-708)||(23614272-23614338)
chr8 (634-736)||(531684-531786)
chr8 (634-711)||(30945452-30945527)
chr8 (634-705)||(3879472-3879543)
chr8 (309-399)||(9189208-9189296)
[»] scaffold0004 (1 HSPs)
scaffold0004 (220-399)||(371929-372108)
[»] scaffold0166 (1 HSPs)
scaffold0166 (634-736)||(30681-30783)
[»] scaffold0096 (1 HSPs)
scaffold0096 (219-261)||(5429-5471)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 11)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 162 - 462
Target Start/End: Complemental strand, 9411493 - 9411194
Alignment:
162 atatatataatgcattaatattttgcatagttgtcaaaatagacttagtcattagagttggatttggatcctctccaaccatttctctcatgttgtttgt 261  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
9411493 atatatatagtgcattaatattttgcatagctgtcaaaatagacttagtcattagagttggacttggatcctctccaaccatttctctcatgttgtttgt 9411394  T
262 cctaccataatctaagccatttattcacctattttctctctctttagtgctgttttttgttcatttatgaaccaatcaaccattggatcagaaaaggaga 361  Q
    ||| |||||||||||||||||||||||||||||||||||||  |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||    
9411393 cctgccataatctaagccatttattcacctattttctctct--ttagtgttgttttttgtttatttatgaaccaatcaaccattggatcagaaaaggaga 9411296  T
362 gggggctgcacaaaaaatgcaggagatgatccaaatccattagagttaaggatggcaaagcgggtcggcccaacctgttt-aactcgtctctcataagcc 460  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||    
9411295 gggggctgcacaaaaaatgcaggagaggatccaaatccattagagttaaggatggcaaagcgggtcggcccaacctgtttaaactcgtctctcttaaacc 9411196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 30624865 - 30625123
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| |||| | |||||| |||||   ||||||||||||||||| |||||||||||||||| |||||||| ||| ||||||||| ||||| |    
30624865 cttctatgaagaagtcgagaaattgacttttttagtgaagtcgtttaattcaaccaatcagatttcaagtcatgacacgtcagatgttgggataaatttt 30624964  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||    
30624965 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaaaattttaacggttagatttgtttggtctctatgttattgtggtacaccct 30625064  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
30625065 ctacacatgatttttcttatttttccaattctctttcctctttatcactcattcatctc 30625123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 151; E-Value: 2e-79
Query Start/End: Original strand, 494 - 752
Target Start/End: Complemental strand, 41413659 - 41413401
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    ||||||||| || |||||| || ||| || |||| ||||||||||| | |   ||||||||||||||||||||||||| ||| ||||| |||||||||||    
41413659 cttctatgatgaagtcgggtaaatgacttcttcggtgaagtcgtttgaatggaccaatcagatttcaagccatgacacgtcagatgttaggacaaattat 41413560  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||  ||||| |||||||||||||||||||||||    
41413559 aatatggatcacttgcttcatatgttccaccgtggacaagtttatttcaagatcttaacggttaggtttacttggtgtctatgttattgtggtacaccct 41413460  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
     |||||||||||||||||||  |||||| |||||||||||||| |||||||| ||||||    
41413459 ttacacatgatttttcttataattccaaatctctttcctctttatcactcatgcatctc 41413401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 150; E-Value: 7e-79
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 14270893 - 14270716
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgttttttg 320  Q
    ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||    
14270893 ggatttggatcctctccaaccatttctttcatgttgtttgtcctgccataatctaagctatttattcacctattttctctctctttaatgctgttttttg 14270794  T
321 ttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatc 398  Q
    |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||    
14270793 ttcatttatgaaccaatcaaccattggatccgtaaaggagagggggctgcacaaaaaaggcaggagatgatccaaatc 14270716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 143; E-Value: 1e-74
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 1828413 - 1828671
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    ||||||||| || |||||| || ||| || |||| ||||||||||| | |   ||||||||||||||||||||||||| ||| |||||  ||||||||||    
1828413 cttctatgatgaagtcgggtaaatgacttcttcggtgaagtcgtttgaatggaccaatcagatttcaagccatgacacgtcagatgttatgacaaattat 1828512  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||  ||||| |||||||||||||||||||||||    
1828513 aatatggatcacttgcttcatatgttccaccgtggacaagtttatttcaagatcttaacggttaggtttacttggtgtctatgttattgtggtacaccct 1828612  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
     |||||||||||||||||||  |||||| ||||| |||||||| |||||||| ||||||    
1828613 ttacacatgatttttcttataattccaaatctctctcctctttatcactcatgcatctc 1828671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 143; E-Value: 1e-74
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 40313878 - 40314136
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    ||||||||| || |||||| || ||| || |||| ||||||||||| | |   ||||||||||||||||||||||||| ||| ||||| ||||||||||     
40313878 cttctatgatgaagtcgggtaaatgacttcttcggtgaagtcgtttgaatggaccaatcagatttcaagccatgacacgtcagatgttaggacaaattac 40313977  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||  ||||| |||||||||||||||||||||||    
40313978 aatatggatcacttgcttcatatgttccaccgtggacaagtttatttcaagatcttaacggttaggtttacttggtgtctatgttattgtggtacaccct 40314077  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
     |||||||||||||||||||  |||||| ||||| |||||||| |||||||| ||||||    
40314078 ttacacatgatttttcttataattccaaatctctctcctctttatcactcatgcatctc 40314136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 9424303 - 9424145
Alignment:
1 tggaaactttgtcaccatacacagtggctgctcgttcaaagaaacagatcggtgtcaaaggtatgtgtgaacctttagagcactcaaccagatcttgtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||    
9424303 tggaaactttgtcaccatacacagtggctgctcgttcaaggaaacagatcggtgtcaaaggtatgtgtgaacctttagagcactcaaccaggtcttgcgt 9424204  T
101 cattgtaacatcctcactggttctggttctgtacggcaggtatttgcttaatacatgca 159  Q
    ||||||||| |||||| |||||||||||||||||||| ||||||||||||||| |||||    
9424203 cattgtaacgtcctcattggttctggttctgtacggctggtatttgcttaatatatgca 9424145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 531 - 708
Target Start/End: Complemental strand, 31482248 - 31482071
Alignment:
531 aagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttcatatgttccaccatagac 630  Q
    ||||||||| | | ||||||||| |||| |||  ||||||| ||| | ||  |||||||||||||||||||||||||||| |||||||||||||||||||    
31482248 aagtcgtttgaatgagccaatcaaattttaagtgatgacacttcagaagtaaggacaaattataatatggatcacttgctccatatgttccaccatagac 31482149  T
631 aagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgattttt 708  Q
    |  |||| |||| |||||||| |||||||||||||||||||||||| |||| ||||||||| ||||||||| ||||||    
31482148 agatttacttcatgatcttaatggttagatttgtttggtctctatggtattatggtacaccatctacacataattttt 31482071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 24788400 - 24788298
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||| | ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
24788400 tttattttatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 24788301  T
734 ttt 736  Q
    |||    
24788300 ttt 24788298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 314 - 387
Target Start/End: Complemental strand, 1278296 - 1278223
Alignment:
314 ttttttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggaga 387  Q
    |||||| |||||||||||||||||||| |||||||  ||| |||||||||| ||||||||||||| ||| ||||    
1278296 tttttttttcatttatgaaccaatcaatcattggactagagaaggagagggagctgcacaaaaaaggcacgaga 1278223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 634 - 701
Target Start/End: Original strand, 39884696 - 39884763
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacat 701  Q
    ||||||||| |||||||| ||||||||||  || |||||||||||||||||||| ||  |||||||||    
39884696 tttatttcatgatcttaatggttagatttacttagtctctatgttattgtggtatactgtctacacat 39884763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 16)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 27292947 - 27293205
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |    
27292947 cttctatgaagaagtcggggaattgactttttcggtgaagtcgtttaattcagccaatcagatttcaagccatgacacgtcatatgttgggacaaattct 27293046  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27293047 aatatggatcacttgtttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 27293146  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
27293147 ctacacatgatttttcttatttttccaattctctttcctctttatcactcattcatctc 27293205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 4919016 - 4919273
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| ||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||| |    
4919016 cttctatgaagaagtcggggaattgactttttcggtgaagtcgtt-aattcagccaatcagatttcaagccatgacacgtcagatgttgggacaaattct 4919114  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||    
4919115 aatatggatcacttgtttcatatgttccaccatagacaagtttatttcaagatcttaatggttagatttgtttggtctctatgatattgtggtacacgct 4919214  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||    
4919215 ctacacatgatttttcttatttttccaattctatttcctctttatcactcattcatctc 4919273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 494 - 736
Target Start/End: Original strand, 42976332 - 42976573
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| |||||  |||||| || ||||||| |||||||||||||| ||||||||||||||||  ||||||| ||| |||| |  | ||||| |    
42976332 cttctatgaagaagtcggacaattgacttcttcgatgcagtcgtttaattcaaccaatcagatttcaagagatgacacgtcacatgtaga-ataaatttt 42976430  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||| |||| || ||||||||||||||||| ||| | |||||||||||||||||||  ||||||||||||||| ||||||||||| |    
42976431 aatatggatcacttgctccataagtcccaccatagacaagtttcttttatgatcttaacggttagatttacttggtctctatgttaatgtggtacaccat 42976530  T
694 ctacacatgatttttcttatttttccaattctctttcctcttt 736  Q
    |||||||||||||||||| |  |  ||||||||| ||||||||    
42976531 ctacacatgatttttcttctagtatcaattctctctcctcttt 42976573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 220 - 400
Target Start/End: Original strand, 54676943 - 54677121
Alignment:
220 tggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctcttta----gtgctgtt 315  Q
    ||||||| |||||||||||||||||||||| |||| |||||| ||  |||||||||||  ||| ||||||  ||||||||||| |||     ||| ||||    
54676943 tggatttagatcctctccaaccatttctcttatgtagtttgttctgtcataatctaag--attcattcac--attttctctctttttccctggtgttgtt 54677038  T
316 ttttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcca 400  Q
    ||||||||||||||||  ||||||||||||| |||||||||| |||  ||| ||||||||||| | |||||| ||||||| ||||    
54677039 ttttgttcatttatgagtcaatcaaccattgaatcagaaaagtaga--gggttgcacaaaaaaggtaggagaggatccaattcca 54677121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 644 - 711
Target Start/End: Complemental strand, 45989676 - 45989609
Alignment:
644 gatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    |||||||||||||||||||  ||||||||||||||||||||||| ||| |||||||||||||||||||    
45989676 gatcttaacggttagatttaattggtctctatgttattgtggtataccatctacacatgatttttctt 45989609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 634 - 711
Target Start/End: Original strand, 20133410 - 20133487
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| |||||||||||||||||||    
20133410 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttctt 20133487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 644 - 736
Target Start/End: Complemental strand, 42069112 - 42069020
Alignment:
644 gatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctcttt 736  Q
    |||||||||||||||||||  ||| ||||||||||||||||||| ||| ||||||||||||||||||| |  || ||||||| | ||||||||    
42069112 gatcttaacggttagatttaattgatctctatgttattgtggtataccatctacacatgatttttcttctaatttcaattctttctcctcttt 42069020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 55919463 - 55919361
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| ||||  |||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
55919463 tttatttcatgattttaatagttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 55919364  T
734 ttt 736  Q
    |||    
55919363 ttt 55919361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 644 - 711
Target Start/End: Complemental strand, 47031525 - 47031458
Alignment:
644 gatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    |||||||| ||||||||||  ||| ||||||||||||||||||| ||| |||||||||||||||||||    
47031525 gatcttaatggttagatttaattgatctctatgttattgtggtataccatctacacatgatttttctt 47031458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 222 - 362
Target Start/End: Original strand, 34114776 - 34114921
Alignment:
222 gatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctct----ctttagtgctgtttt 317  Q
    ||||||||||||||||||| |||| ||| || |||||||| ||    | ||||||| |||| |||| ||| ||||||||||    ||||||| | ||||     
34114776 gatttggatcctctccaactatttttctgatattgtttgttctgttgttatctaagtcattcattccccttttttctctctatctctttagtaccgtttc 34114875  T
318 ttgttcatttatgaaccaatcaa-ccattggatcagaaaaggagag 362  Q
    |||||||| |||||||||||||| |||||| |||||||||| ||||    
34114876 ttgttcatctatgaaccaatcaacccattgaatcagaaaagaagag 34114921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 634 - 705
Target Start/End: Complemental strand, 15531287 - 15531216
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    ||||||||| |||||||| ||||||||||  || |||||||||||||||||||| ||  |||||||||||||    
15531287 tttatttcatgatcttaatggttagatttacttagtctctatgttattgtggtatactgtctacacatgatt 15531216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 28679508 - 28679610
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||| | ||||||||  |||| ||||  ||| ||||||||||||||||||| ||| ||||||||||||||||||| |  | |||||| ||| |||||    
28679508 tttattttatgatcttaatagttaaatttacttgatctctatgttattgtggtataccatctacacatgatttttcttctagtaccaattttctctcctc 28679607  T
734 ttt 736  Q
    |||    
28679608 ttt 28679610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 217 - 397
Target Start/End: Original strand, 48351638 - 48351822
Alignment:
217 agttggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctat-tttctctctctttagtgc---t 312  Q
    ||||||||||| ||||| || |||||||||||||| |||||| ||  | ||||||||||||||||| ||| |||  | | ||||||||| |   ||   |    
48351638 agttggatttgaatcctttcgaaccatttctctcacgttgttggttatgccataatctaagccattcatttaccactctctctctctctctctcgccttt 48351737  T
313 gttttttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaat 397  Q
     ||||||||| ||||  || ||||||||||||| ||| | ||||| ||||||| |||||||||||| | |||||| |||| ||||    
48351738 tttttttgtttattttcgagccaatcaaccattagattataaaagaagaggggactgcacaaaaaaggtaggagacgatctaaat 48351822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 220 - 329
Target Start/End: Original strand, 9595018 - 9595127
Alignment:
220 tggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgtttttt 319  Q
    |||| ||||||||| |||||||||||||||| || | ||||| ||  ||  |||||||||||||||| |||  |||||| |||  || ||  ||||||||    
9595018 tggagttggatcctgtccaaccatttctctcttgctatttgttctgtcacgatctaagccatttatttaccctttttctttcttattggtattgtttttt 9595117  T
320 gttcatttat 329  Q
    ||||||||||    
9595118 gttcatttat 9595127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 494 - 581
Target Start/End: Complemental strand, 24228360 - 24228273
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgtt 581  Q
    ||||||||| || |||||| || ||| || |||| ||||||||||| | |   ||||||||||||||||||||||||| ||| |||||    
24228360 cttctatgatgaagtcgggtaaatgacttcttcggtgaagtcgtttgaatggaccaatcagatttcaagccatgacacgtcagatgtt 24228273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 222 - 252
Target Start/End: Original strand, 17643733 - 17643763
Alignment:
222 gatttggatcctctccaaccatttctctcat 252  Q
    |||||||||||||||||||||||||||||||    
17643733 gatttggatcctctccaaccatttctctcat 17643763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 223; Significance: 1e-122; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 494 - 752
Target Start/End: Complemental strand, 50650608 - 50650350
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| ||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |    
50650608 cttctatgaagaagtcggggaattgactttttcggtaaagtcgtttaattcagccaatcagatttcaagccatgacacgtcagatgttgggacaaattct 50650509  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50650508 aatatggatcacttgtttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 50650409  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
50650408 ctacacatgatttttcttatttttccaattctctttcctctttatcactcattcatctc 50650350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 147; E-Value: 4e-77
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 12938402 - 12938660
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    ||||||||| || |||||| || ||| || |||| ||||||||||| | |   ||||||||||||||||||||||||| ||| ||||| |||||||||||    
12938402 cttctatgatgaagtcgggtaaatgacttcttcggtgaagtcgtttgaatggaccaatcagatttcaagccatgacacgtcagatgttaggacaaattat 12938501  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||  ||||| |||||||||||||||||||||||    
12938502 aatatggatcacttgcttcatatgttccaccgtggacaagtttatttcaagatcttaacggttaggtttacttggtgtctatgttattgtggtacaccct 12938601  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
     |||||||||||||||||||  |||||| ||||| |||||||| |||||||| ||||||    
12938602 ttacacatgatttttcttataattccaaatctctctcctctttatcactcatgcatctc 12938660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 514 - 736
Target Start/End: Complemental strand, 31659015 - 31658794
Alignment:
514 aattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttca 613  Q
    |||||| || |||| || |||||||||||||| ||||||||||||||||  ||||||||||| |||| || | ||||| |||||||||||||||||| ||    
31659015 aattgacttcttcggtgcagtcgtttaattcaaccaatcagatttcaagagatgacacatcacatgtagg-ataaattctaatatggatcacttgctcca 31658917  T
614 tatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttat 713  Q
    || || ||||||||||||||||| ||| | |||||||||||||||||||  ||||||||||||||||||||||||||| ||||||||||||||||||| |    
31658916 taagtcccaccatagacaagtttcttttatgatcttaacggttagatttacttggtctctatgttattgtggtacaccatctacacatgatttttcttct 31658817  T
714 ttttccaattctctttcctcttt 736  Q
      |  ||||||||| ||||||||    
31658816 aatatcaattctctctcctcttt 31658794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 524 - 708
Target Start/End: Complemental strand, 33216841 - 33216657
Alignment:
524 ttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttcatatgttccac 623  Q
    |||| ||||||||||| | | |||||||||||||| |||  ||||||| || || ||   ||||||||||||||||||||||||||| ||||||||||||    
33216841 ttcggtgaagtcgtttgaatgagccaatcagattttaagtgatgacacgtcctaagtaatgacaaattataatatggatcacttgctccatatgttccac 33216742  T
624 catagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgattttt 708  Q
    ||||||||  |||| |||| |||||||| |||||||||||||||| ||||||| |||| ||||||| | ||||| ||| ||||||    
33216741 catagacagatttacttcatgatcttaatggttagatttgtttggcctctatggtattatggtacagcatctacgcataattttt 33216657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 529 - 701
Target Start/End: Original strand, 29833311 - 29833483
Alignment:
529 tgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttcatatgttccaccatag 628  Q
    ||||||||||| | | | |||||||||||| |||  ||||||| ||| | ||  |||||||||||||||||||||||||||| |||||||||||||||||    
29833311 tgaagtcgtttgaatgaaccaatcagattttaagtgatgacacgtcagaagtaaggacaaattataatatggatcacttgctccatatgttccaccatag 29833410  T
629 acaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacat 701  Q
    |||  |||| || | |||||||| ||||||||||||||||| |||||| |||| ||||||||| ||| |||||    
29833411 acagatttacttgatgatcttaatggttagatttgtttggtttctatggtattatggtacaccatcttcacat 29833483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 221 - 361
Target Start/End: Complemental strand, 34387573 - 34387435
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctg-tttttt 319  Q
    |||||||||| |||||||||||||||||| |||||||||||  |  |||||||||||||||| ||||||   |||||||||||||  ||| || ||||||    
34387573 ggatttggattctctccaaccatttctcttatgttgtttgttttgtcataatctaagccattaattcac---ttttctctctcttaggtgttgttttttt 34387477  T
320 gttcatttatgaaccaatcaaccattggatcagaaaaggaga 361  Q
    |||||  |||||  |||||||||||||||||||| |||||||    
34387476 gttcaactatgagtcaatcaaccattggatcagagaaggaga 34387435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 634 - 711
Target Start/End: Complemental strand, 39833307 - 39833230
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| |||||||||||||||||||    
39833307 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttctt 39833230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 279 - 353
Target Start/End: Complemental strand, 1292301 - 1292228
Alignment:
279 catttattcacctattttctctctctttagtgctgttttttgttcatttatgaaccaatcaaccattggatcaga 353  Q
    ||||||||||| | |||||||| ||||| ||| || ||||||||||||||||| |||||||||||||||||||||    
1292301 catttattcactt-ttttctctgtctttggtgttgatttttgttcatttatgagccaatcaaccattggatcaga 1292228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 274 - 378
Target Start/End: Complemental strand, 1294865 - 1294763
Alignment:
274 taagccatttattcacctattttctctctctttagtgctgttttttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcaca 373  Q
    |||| ||||||||||| | |||||||| ||||| ||| ||| | ||||||||| ||||  |||||||||||||||||||||||||| |||||| |||| |    
1294865 taagtcatttattcactt-ttttctctttctttggtgttgtgtattgttcatt-atgagtcaatcaaccattggatcagaaaaggaaagggggttgcata 1294768  T
374 aaaaa 378  Q
    |||||    
1294767 aaaaa 1294763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 634 - 705
Target Start/End: Complemental strand, 29703612 - 29703541
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    ||||||||| |||||||| ||||||||||  || |||||||||||||||||||| ||  |||||||||||||    
29703612 tttatttcatgatcttaatggttagatttacttagtctctatgttattgtggtatactgtctacacatgatt 29703541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 634 - 705
Target Start/End: Complemental strand, 36950234 - 36950163
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    ||||||||| |||||||| ||||||||||  ||||||||||||||||||||||| |   |||||||||||||    
36950234 tttatttcatgatcttaatggttagatttacttggtctctatgttattgtggtatattgtctacacatgatt 36950163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 634 - 732
Target Start/End: Original strand, 5232946 - 5233044
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcct 732  Q
    ||||||||| ||||||||  |||||||||  ||| ||| ||||||||||||||||| | ||||||||||| ||||||| |  | |||||||||| ||||    
5232946 tttatttcatgatcttaatagttagatttacttgatctttatgttattgtggtacaacatctacacatgaattttcttctagtaccaattctctctcct 5233044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 634 - 732
Target Start/End: Original strand, 20104322 - 20104420
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcct 732  Q
    ||||||||| |||||||| ||||||||||  ||| ||| ||||||||||||||||| | ||||||||| | ||||||| |  | |||||||||| ||||    
20104322 tttatttcatgatcttaatggttagatttacttgatctttatgttattgtggtacaacatctacacattaattttcttctagtaccaattctctctcct 20104420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 634 - 705
Target Start/End: Original strand, 53282294 - 53282365
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    |||||||||  ||||||| ||||||||||  || |||||||||||||||||||| ||  |||||||||||||    
53282294 tttatttcattatcttaatggttagatttacttagtctctatgttattgtggtatactgtctacacatgatt 53282365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 494 - 751
Target Start/End: Original strand, 27286165 - 27286422
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| |||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| || || |    
27286165 cttctatgaagaagtcgaggaattgactttttcggtgaagtcgtttaattcagccaatcagatttcaagccatgacacgtcagatgttgggaaaattttt 27286264  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
27286265 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaaaatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 27286364  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatct 751  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
27286365 ctacacatgatttttcttatttttccaattctctttcctctttatcactcattcatct 27286422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 494 - 752
Target Start/End: Complemental strand, 52386030 - 52385772
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| || ||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
52386030 cttctatgaagaagttgggaaattgactttttcggtgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattct 52385931  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    || ||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
52385930 aaaatggatcacgtgtttcatatgttccaccatagacaagtttatttcaagatctttacggttagatttgtttgatctctatgttattgtggtacaccct 52385831  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||    
52385830 ctacacatgatttttcttacttttccaattctctttcctctttatcacccattcatctc 52385772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 223 - 399
Target Start/End: Complemental strand, 27528347 - 27528170
Alignment:
223 atttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgtt-ttttgt 321  Q
    |||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||    
27528347 atttcgatcctctccaaccatttctctcatgttgtttgtcctgccataacctaagccatttattcacctattttctcactctttagtgctgtttttttgt 27528248  T
322 tcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    ||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| |||||||| |||||||||||    
27528247 tcatttatgaaccaatcaaccattggatcagaaaatgagaggaggctacacaaaaaaggcaggagaggatccaaatcc 27528170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 221 - 387
Target Start/End: Complemental strand, 32800723 - 32800554
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccattt---attcacctattttctctctctttagtgctgtttt 317  Q
    ||||||||||||||| |||||||| ||||||||||||||||| | | ||||| ||||||||||   |||||||||||||||||||||||||||||| |||    
32800723 ggatttggatcctcttcaaccattcctctcatgttgtttgtcttgctataatttaagccattttttattcacctattttctctctctttagtgctgattt 32800624  T
318 ttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggaga 387  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||  ||||| ||||||||||||||||    
32800623 ttgttcttttatgaaccaatcaactattggatcagaaaaggagaggaagctgcgcaaaaaatgcaggaga 32800554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 494 - 711
Target Start/End: Original strand, 39241559 - 39241773
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgttt-aattcagccaatcagatttcaagccatgacacatcatatgttgggacaaatta 592  Q
    |||||||||||| ||  || || ||| || |||||||||||||||| |||   | ||||||||||| |||  || |||| ||| |||||| ||||||||     
39241559 cttctatgaagaagttaggaaaatgacttcttcgatgaagtcgtttgaatggggtcaatcagattttaagtgataacacgtcagatgttgagacaaattc 39241658  T
593 taatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccc 692  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||   ||   ||| |||||||||||||||||     
39241659 taatatg-atcacttgcttcatatgttccaccatagacaagtttatttcatgatcttaacggttagatttacctg---tctttgttattgtggtacacca 39241754  T
693 tctacacatgatttttctt 711  Q
    |||||||||||||||||||    
39241755 tctacacatgatttttctt 39241773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 34105859 - 34106039
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattca-cctattt---tctctctctttagtgctgttt 316  Q
    ||||||| ||||||||| |||||||||||||||  |||||| ||||||||||||||| |||| ||||| ||| | |   |||| |||| | ||  |||||    
34105859 ggatttgaatcctctccgaccatttctctcatgcagtttgttctaccataatctaaggcattcattcagcctctctccctctccctctctcgtattgttt 34105958  T
317 tttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    |||||||||||||||  |||||||||||| ||||||||||  |||| | ||||||||||||| |||||||| |||||||||||    
34105959 tttgttcatttatgagtcaatcaaccattagatcagaaaa--agagagagctgcacaaaaaaagcaggagaagatccaaatcc 34106039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 12981521 - 12981623
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
12981521 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 12981620  T
734 ttt 736  Q
    |||    
12981621 ttt 12981623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 45348344 - 45348242
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
45348344 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 45348245  T
734 ttt 736  Q
    |||    
45348244 ttt 45348242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 644 - 710
Target Start/End: Complemental strand, 45325701 - 45325635
Alignment:
644 gatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttct 710  Q
    |||||||||||||||||||  || |||||||||||||||||||| ||| ||||||||||||||||||    
45325701 gatcttaacggttagatttaattagtctctatgttattgtggtataccatctacacatgatttttct 45325635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 498 - 752
Target Start/End: Original strand, 19436677 - 19436931
Alignment:
498 tatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataata 597  Q
    |||||||| || ||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||    
19436677 tatgaagaagttggggaatagactttttcggtgaagtcgtttaattcagccaatcagatttcaagccatgatacgtcatatgttgggacaaattctaata 19436776  T
598 tggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctac 697  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||    
19436777 tggatcacttgtttcatatgttccaccatagacaagtttatttcaagatcttaacagttagatttgtttggtctctatgttattgtggtacaccctatac 19436876  T
698 acatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
19436877 acatgatttttcttatttttccaattctctttcctctttatcactcattcatctc 19436931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 494 - 752
Target Start/End: Complemental strand, 29834161 - 29833903
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||| ||||| ||||||||||||| ||||| | | ||||||||||||||||||||||||||||||||||||||||  ||| ||||||||||||| | |    
29834161 cttctacgaagaagtcggggaattgacttttttggtaaagtcgtttaattcagccaatcagatttcaagccatgacatgtcagatgttgggacaaactct 29834062  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||    
29834061 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacagttagatttgtttggtctctatgttattgtggtaaaccct 29833962  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    || ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||    
29833961 ctgcacatgattttacttatttttccaattctctttcctctttatcactcattcatctc 29833903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 494 - 662
Target Start/End: Original strand, 29258388 - 29258556
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| |||||| |||||| || ||||||| ||| |||| | |  |||||||||||||||||  ||||||| ||| ||  ||| ||||||| |    
29258388 cttctatgaagaagtcgggcaattgacttcttcgatgcagttgtttgaatgggccaatcagatttcaagtgatgacacgtcagataatgg-acaaattct 29258486  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatc-ttaacggttagattt 662  Q
    || |||||||||||||| ||| ||||||||| | |||||||||||||||  ||| |||||||||||||||    
29258487 aacatggatcacttgctccatgtgttccaccgtggacaagtttatttcataatctttaacggttagattt 29258556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 45972423 - 45972525
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
45972423 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 45972522  T
734 ttt 736  Q
    |||    
45972523 ttt 45972525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 644 - 711
Target Start/End: Original strand, 6442636 - 6442703
Alignment:
644 gatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||| |||||||||  ||||||||||||||||||||||| ||| |||||||||||||||||||    
6442636 gatcttaactgttagatttaattggtctctatgttattgtggtataccatctacacatgatttttctt 6442703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 645 - 711
Target Start/End: Original strand, 34094118 - 34094184
Alignment:
645 atcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||||||||||||  ||| ||||||||||||||||||| ||| |||||||||||||||||||    
34094118 atcttaacggttagatttaattgatctctatgttattgtggtataccatctacacatgatttttctt 34094184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 634 - 711
Target Start/End: Original strand, 29243380 - 29243455
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||| |||||||| ||||||||||  ||| |||||||  |||||||||||||| |||||||||||||||||||    
29243380 tttatttcatgatcttaatggttagatttacttgatctctat--tattgtggtacaccatctacacatgatttttctt 29243455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 634 - 732
Target Start/End: Original strand, 47327942 - 47328040
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcct 732  Q
    ||||||||| ||||||||  |||||||||  ||| ||| ||||||||||||||||| | ||||||||||| ||||||| |  | |||||||||| ||||    
47327942 tttatttcatgatcttaatagttagatttacttgatctttatgttattgtggtacaacatctacacatgaattttcttctagtaccaattctctctcct 47328040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 20439260 - 20439328
Alignment:
223 atttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacct 291  Q
    ||||| ||||||||||||||||||| |||||| |||| | || ||||||||||| ||||| ||||||||    
20439260 atttgtatcctctccaaccatttctatcatgtcgtttattctgccataatctaaaccattcattcacct 20439328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 221 - 342
Target Start/End: Original strand, 34974809 - 34974926
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgtttt-tt 319  Q
    ||||||||||| ||| ||| |||||||   ||| ||||||| |||   ||||||||| |||||||| |||| |||   |||||||| |||||||||| ||    
34974809 ggatttggatcttcttcaatcatttctg--atgctgtttgttctattgtaatctaagtcatttattaaccttttt---ctctctttcgtgctgttttttt 34974903  T
320 gttcatttatgaaccaatcaacc 342  Q
    |||||||||||| ||||||||||    
34974904 gttcatttatgagccaatcaacc 34974926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 14096257 - 14096515
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||| |    
14096257 cttctatgaagaagtcggggaattgactttttcggtgaagtcgtttaattcagccaatcagatttcaagacatgacacgtcagatgttgggacaaattct 14096356  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||    
14096357 aatatggatcacttgtttcatatgttccaccatagacaagtttatttcaagatcttaaccgttagatttgtttggtctctatgatattgtggtacacgct 14096456  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||    
14096457 ctacacatgatttttcttatttttccaattctatttcctctttatcactcattcatctc 14096515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 115; E-Value: 5e-58
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 15819968 - 15819792
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgttttttg 320  Q
    ||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||   || |||||||| |||||||||||||| |||||||||||||    
15819968 ggatttggatcctctccaaccatttctctaatgttgtttgttctgccataatctaagtagttcattcacct-ttttctctctctttggtgctgttttttg 15819870  T
321 ttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||  ||||||| |||||||||||    
15819869 ttcatttatgaaccaatcaaccattggatcagaaaaagaga-ggggctgcacaaaaaagacaggagaggatccaaatcc 15819792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 222 - 396
Target Start/End: Complemental strand, 34312127 - 34311952
Alignment:
222 gatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttct-ctctctttagtgctgttttttg 320  Q
    ||||||||||||||||||||||||| |||||||||||||| ||  ||||||||||| |||| ||| |||| |||| | || ||||| ||| |||||||||    
34312127 gatttggatcctctccaaccatttcgctcatgttgtttgttctgtcataatctaagtcattcatttacctgtttttttctttctttggtgttgttttttg 34312028  T
321 ttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaa 396  Q
    ||||||||||| ||||||||||||||||||||||||  |||||||||||||||||||| |||||||| ||||||||    
34312027 ttcatttatgagccaatcaaccattggatcagaaaaaaagagggggctgcacaaaaaaggcaggagaggatccaaa 34311952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 71; E-Value: 9e-32
Query Start/End: Original strand, 242 - 360
Target Start/End: Complemental strand, 41696685 - 41696567
Alignment:
242 atttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgttttttgttcatttatgaaccaatcaac 341  Q
    |||| ||||||||| |||||||| ||||||||| | |||||||||||||| |||||| |||||||  || ||| ||||||||||||||||||||||||||    
41696685 atttttctcatgttatttgtcctgccataatcttaaccatttattcaccttttttctatctctttgatgttgtcttttgttcatttatgaaccaatcaac 41696586  T
342 cattggatcagaaaaggag 360  Q
    |||| ||||||||||||||    
41696585 cattcgatcagaaaaggag 41696567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 621 - 736
Target Start/End: Complemental strand, 18977200 - 18977085
Alignment:
621 caccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttcca 720  Q
    |||||| ||||||||||||||| ||||||||| |||||||||  || |||||||||||||||||||||||| ||||||||| | ||||||| |  | |||    
18977200 caccatggacaagtttatttcatgatcttaacagttagatttacttagtctctatgttattgtggtacaccatctacacataacttttcttctagtacca 18977101  T
721 attctctttcctcttt 736  Q
    ||| ||| ||||||||    
18977100 attatctctcctcttt 18977085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 14810191 - 14810089
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| |||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
14810191 tttatttcatgattttaatggttagatttatttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 14810092  T
734 ttt 736  Q
    |||    
14810091 ttt 14810089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 15330735 - 15330837
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
15330735 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 15330834  T
734 ttt 736  Q
    |||    
15330835 ttt 15330837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 221 - 397
Target Start/End: Complemental strand, 36922716 - 36922526
Alignment:
221 ggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcac--ctattttctctctctttagtgctgttttt 318  Q
    |||||||||| |||||||||||||||||||||||||||||| |  ||||||| |||| |||| ||||||   | |||||||||||||| || | ||||||    
36922716 ggatttggattctctccaaccatttctctcatgttgtttgttccgccataatttaagtcattcattcactttttttttctctctctttggtaccgttttt 36922617  T
319 t------------gttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaat 397  Q
    |             |||| ||||||  |||||||| ||||||||||||||| ||||| |||||||||||||| ||| |||| |||||||||    
36922616 tttcttttctttccttcaattatgagtcaatcaactattggatcagaaaagaagaggaggctgcacaaaaaaggcatgagaggatccaaat 36922526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 37261773 - 37261671
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
37261773 tttatttcatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 37261674  T
734 ttt 736  Q
    |||    
37261673 ttt 37261671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 16429864 - 16429966
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||||| ||| |||| ||||||||||  ||| ||||||||||||| ||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
16429864 tttatttcatgattttaatggttagatttacttgatctctatgttattatggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 16429963  T
734 ttt 736  Q
    |||    
16429964 ttt 16429966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 17690604 - 17690706
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||| | ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
17690604 tttattttatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 17690703  T
734 ttt 736  Q
    |||    
17690704 ttt 17690706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 580
Target Start/End: Complemental strand, 18977302 - 18977216
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgt 580  Q
    |||||||||||| ||| || || ||| || ||||||||||||||||||||||||||||||||||| |||  ||||||| ||| ||||    
18977302 cttctatgaagaagtcaggaaaatgacttcttcgatgaagtcgtttaattcagccaatcagattttaagtgatgacacgtcacatgt 18977216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 634 - 732
Target Start/End: Original strand, 37078947 - 37079045
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcct 732  Q
    ||||||||| ||||||||  |||||||||  ||| ||| ||||||||||||||||| | ||||||||||| ||||||| |  | |||||||||| ||||    
37078947 tttatttcatgatcttaatagttagatttacttgatctttatgttattgtggtacaacatctacacatgaattttcttctagtaccaattctctctcct 37079045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 634 - 687
Target Start/End: Original strand, 7089225 - 7089278
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggta 687  Q
    ||||||||| |||||||| ||||||||||  ||| |||||||||||||||||||    
7089225 tttatttcatgatcttaatggttagatttacttgatctctatgttattgtggta 7089278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 634 - 705
Target Start/End: Complemental strand, 33755146 - 33755075
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    ||||||||| ||| |||| ||||||||||  ||||||| ||||||||||||||| |   |||||||||||||    
33755146 tttatttcatgatattaatggttagatttacttggtctatatgttattgtggtatattgtctacacatgatt 33755075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 347 - 388
Target Start/End: Complemental strand, 41696549 - 41696508
Alignment:
347 gatcagaaaaggagagggggctgcacaaaaaatgcaggagat 388  Q
    |||||||||||||||||||| | ||||||||| |||||||||    
41696549 gatcagaaaaggagagggggttacacaaaaaaggcaggagat 41696508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 12938643 - 12938901
Alignment:
494 cttctatgaagaggtcggggaattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattat 593  Q
    |||||||||||| |||| | |||||| |||||   ||||||||||||||||| |||||||||||| |||| ||||||| ||| ||||||||||||||| |    
12938643 cttctatgaagaagtcgagaaattgacttttttagtgaagtcgtttaattcaaccaatcagattttaagcgatgacacgtcagatgttgggacaaatttt 12938742  T
594 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 693  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12938743 aatatggatcacttgcttcatatgttccaccatagacaagtttatttcaaaatcttaacggttagatttgtttggtctctatgttattgtggtacaccct 12938842  T
694 ctacacatgatttttcttatttttccaattctctttcctctttgtcactcattcatctc 752  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12938843 ctacacatgatttttcttatttttccaattctctttcctctttatcactcattcatctc 12938901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 103; E-Value: 7e-51
Query Start/End: Original strand, 514 - 752
Target Start/End: Original strand, 33694802 - 33695039
Alignment:
514 aattgaatttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttca 613  Q
    |||||| ||||||| ||||||||||| | |   |||||||||||| |||  ||||||| | | ||  ||| | ||||| |||||||||||||||||| ||    
33694802 aattgactttttcggtgaagtcgtttgaatggaccaatcagattttaagtgatgacacgttagataatggaa-aaattttaatatggatcacttgctcca 33694900  T
614 tatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttat 713  Q
    ||||||||| ||||||||| ||||||||| ||||||||| ||||||||| ||||| |||||| |||||||||||||||||||||| ||||||||||||||    
33694901 tatgttccatcatagacaaatttatttcatgatcttaacagttagatttatttggcctctatattattgtggtacaccctctacatatgatttttcttat 33695000  T
714 ttttccaattctctttcctctttgtcactcattcatctc 752  Q
      ||||| |||||| || ||||| |||||||||||||||    
33695001 aattccatttctctctcttctttatcactcattcatctc 33695039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 532 - 711
Target Start/End: Complemental strand, 28138217 - 28138039
Alignment:
532 agtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttcatatgttccaccatagaca 631  Q
    |||||||||||||||||||||| |||||||| |||||||| ||| |||| || ||||||| ||||||||| |||||||| ||||||| ||| ||| ||||    
28138217 agtcgtttaattcagccaatcaaatttcaagtcatgacacgtcagatgtagg-acaaattttaatatggaccacttgctccatatgtcccatcatggaca 28138119  T
632 agtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||||| |||||||| ||||||||||  ||||||||||| ||||||||||||  | |||||||||||||||||||    
28138118 agtttatttcatgatcttaaaggttagatttacttggtctctatattattgtggtacgtcatctacacatgatttttctt 28138039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 604 - 668
Target Start/End: Complemental strand, 14532115 - 14532051
Alignment:
604 acttgcttcatatgttccaccatagacaagtttatttcaagatcttaacggttagatttgtttgg 668  Q
    |||||||  ||||||| |||||| |||| ||||| |||| |||||||| ||||||||||||||||    
14532115 acttgctctatatgtttcaccatggacaggtttacttcacgatcttaatggttagatttgtttgg 14532051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 154; Significance: 3e-81; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 3e-81
Query Start/End: Original strand, 218 - 399
Target Start/End: Complemental strand, 29308853 - 29308672
Alignment:
218 gttggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgtttt 317  Q
    |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
29308853 gttggatttggatcctctccaaccatttctcttatgttgtttgtcctgccataatctaagccatttattcacctattttatctctctttagtgctgtttt 29308754  T
318 ttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||    
29308753 ttgttcatttatcaaccaatcaaccattggatcagaaaaggaaagggggctgcacaaaaaaggcaggagaggatccaaatcc 29308672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 220 - 378
Target Start/End: Complemental strand, 10309316 - 10309158
Alignment:
220 tggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcac-ctattttctctctctttagtgctgttttt 318  Q
    |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| || || ||||||  | |||||||||| ||||||| || ||||    
10309316 tggatttggatcctctccaaccatttctctcatgttgtttgttctactataatctaaacctttcattcacttttttttctctctatttagtgttg-tttt 10309218  T
319 tgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaa 378  Q
    |||||||||||||||||||||||||||| || |||||| ||||||| |||||||||||||    
10309217 tgttcatttatgaaccaatcaaccattgaattagaaaatgagagggagctgcacaaaaaa 10309158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 521 - 708
Target Start/End: Complemental strand, 13802869 - 13802682
Alignment:
521 tttttcgatgaagtcgtttaattcagccaatcagatttcaagccatgacacatcatatgttgggacaaattataatatggatcacttgcttcatatgttc 620  Q
    ||||||| | ||||||||| | | | |||||||||||| |||  ||||||| ||| | ||  |||||||||||||||||||||||||||| |||||||||    
13802869 tttttcggtaaagtcgtttgaatgaaccaatcagattttaagtgatgacacgtcagaagtaaggacaaattataatatggatcacttgctccatatgttc 13802770  T
621 caccatagacaagtttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgattttt 708  Q
    |||||||||||  |||| || | |||||||| |||||||||||||||||||||||  |||| ||||||||| ||||||||| ||||||    
13802769 caccatagacagatttacttgatgatcttaatggttagatttgtttggtctctatcgtattatggtacaccatctacacataattttt 13802682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 584 - 708
Target Start/End: Original strand, 23613574 - 23613699
Alignment:
584 gacaaattataatatggatcacttgcttcatatgttccaccatagacaagtttatttc-aagatcttaacggttagatttgtttggtctctatgttattg 682  Q
    |||||||| ||||||||| ||||||||  |||||||||||||| || || ||| |||  ||||||||||||||||||||||||||||||| ||| |||||    
23613574 gacaaattctaatatggaccacttgctcaatatgttccaccatggataactttttttttaagatcttaacggttagatttgtttggtctccatgatattg 23613673  T
683 tggtacaccctctacacatgattttt 708  Q
    ||||||| ||||||||||||||||||    
23613674 tggtacagcctctacacatgattttt 23613699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 642 - 708
Target Start/End: Original strand, 23614272 - 23614338
Alignment:
642 aagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgattttt 708  Q
    ||||||||||||||||||||||||||||||| ||  |||||||| ||||||||||||||||||||||    
23614272 aagatcttaacggttagatttgtttggtctccataatattgtggcacaccctctacacatgattttt 23614338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Original strand, 531684 - 531786
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    |||||||||  || |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
531684 tttatttcataattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 531783  T
734 ttt 736  Q
    |||    
531784 ttt 531786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 634 - 711
Target Start/End: Complemental strand, 30945527 - 30945452
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttctt 711  Q
    ||||||||| |||||||| ||||||||||  ||| |||||||  |||||||||||||| |||||||||||||||||||    
30945527 tttatttcatgatcttaatggttagatttacttgatctctat--tattgtggtacaccatctacacatgatttttctt 30945452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 634 - 705
Target Start/End: Complemental strand, 3879543 - 3879472
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatt 705  Q
    ||||||||| |||||||| ||||||||||  ||||||||||||||||||||||| |   |||||||||||||    
3879543 tttatttcatgatcttaatggttagatttacttggtctctatgttattgtggtatattgtctacacatgatt 3879472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 309 - 399
Target Start/End: Original strand, 9189208 - 9189296
Alignment:
309 tgctgttttttgttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    ||||||||||| |||||| |  |||||||||| |||||||||| |||||||||| ||| |||| |||||| ||   ||| |||||||||||    
9189208 tgctgtttttttttcattaa--aaccaatcaatcattggatcaaaaaaggagagagggttgcataaaaaaggcgaaagaggatccaaatcc 9189296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 132; Significance: 4e-68; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 220 - 399
Target Start/End: Original strand, 371929 - 372108
Alignment:
220 tggatttggatcctctccaaccatttctctcatgttgtttgtcctaccataatctaagccatttattcacctattttctctctctttagtgctgtttttt 319  Q
    ||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| ||||||||||| |||||||| |||||||||||||| |||||    
371929 tggatttggatcctctccaactatttctctcatgttatttgtcctgccataatctaagtcatttattcacatattttctttctctttagtgctgcttttt 372028  T
320 gttcatttatgaaccaatcaaccattggatcagaaaaggagagggggctgcacaaaaaatgcaggagatgatccaaatcc 399  Q
    ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||  |||| |||||||||||    
372029 gttcatttatgaaccaatcaaccgttggatcaaaaaaggagagggggctgcacaaaaaatgctagagaggatccaaatcc 372108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 634 - 736
Target Start/End: Complemental strand, 30783 - 30681
Alignment:
634 tttatttcaagatcttaacggttagatttgtttggtctctatgttattgtggtacaccctctacacatgatttttcttatttttccaattctctttcctc 733  Q
    ||||||| | ||| |||| ||||||||||  ||| ||||||||||||||||||||||| ||||||||||||||||||| |  | |||||| ||| |||||    
30783 tttattttatgattttaatggttagatttacttgatctctatgttattgtggtacaccatctacacatgatttttcttctagtaccaattttctctcctc 30684  T
734 ttt 736  Q
    |||    
30683 ttt 30681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0096 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0096
Description:

Target: scaffold0096; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 5471 - 5429
Alignment:
219 ttggatttggatcctctccaaccatttctctcatgttgtttgt 261  Q
    |||||||| |||||||||||||||||||||||||  |||||||    
5471 ttggatttagatcctctccaaccatttctctcataatgtttgt 5429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142496 times since January 2019
Visitors: 1480