View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_10 (Length: 384)

Name: NF1565_low_10
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_10
[»] chr8 (5 HSPs)
chr8 (17-251)||(38865761-38865995)
chr8 (301-375)||(38866040-38866114)
chr8 (107-187)||(38841834-38841906)
chr8 (29-94)||(38862383-38862444)
chr8 (128-173)||(38850285-38850329)

Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 38865761 - 38865995
17 ttaagtacaatcttcatgcaagtggttatatcgcaatatatatgtttggtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgaca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865761 ttaagtacaatcttcatgcaagtggttatatcgcaatatatatgttttgtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgaca 38865860  T
117 acaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaatctaagtaatactatttgtctacagctata 216  Q
38865861 acaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaatctaagtaatactatttgtctacagctata 38865960  T
217 cgtacttttgtgcggaaaaagtgcttgtgcttgtg 251  Q
38865961 cgtacttttgtgcggaaaaagtgcttgtgcttgtg 38865995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 301 - 375
Target Start/End: Original strand, 38866040 - 38866114
301 agcttcttggcaatttggatgaagtagtagggcacatcgtgaattagtatagtaaccacggaagacaagaattat 375  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
38866040 agcttcttggcaatttggatgaagtagtagggcacatagtgaattagtatagtaaccacggaagacaagaattat 38866114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 107 - 187
Target Start/End: Original strand, 38841834 - 38841906
107 gtaaatgacaacaattgatcgatcaaattgacaaaatgtttaagctaattaaatttgatctgcaatctaatgtaatgtaat 187  Q
    ||||||||||||||||||||    |||||||||||||||||||||    |||||||||||||||||||||| |||| ||||    
38841834 gtaaatgacaacaattgatc----aaattgacaaaatgtttaagc----taaatttgatctgcaatctaatataatttaat 38841906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 94
Target Start/End: Original strand, 38862383 - 38862444
29 ttcatgcaagtggttatatcgcaatatatatgtttggtttaagaagacgtggttcctaattaaagc 94  Q
    |||||||||||||||| |||| |||||||    ||||||||||||| ||||| |||||||||||||    
38862383 ttcatgcaagtggttagatcgtaatatat----ttggtttaagaagtcgtggctcctaattaaagc 38862444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 173
Target Start/End: Complemental strand, 38850329 - 38850285
128 atcaaattgacaaaatgtttaagctaattaaatttgatctgcaatc 173  Q
    ||||||||| ||||||||||||||||||| |||||||| |||||||    
38850329 atcaaattggcaaaatgtttaagctaatt-aatttgatatgcaatc 38850285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149189 times since January 2019
Visitors: 1516