View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_12 (Length: 359)

Name: NF1565_low_12
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_12
[»] chr6 (1 HSPs)
chr6 (1-354)||(898312-898663)

Alignment Details
Target: chr6 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 898312 - 898663
1 acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga 100  Q
898312 acctcaaaccatcatagacgaaattattaacctttgtccagatttcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcga 898411  T
101 cacaaccaaggtcggttttacctgaattttgacatagagaggtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata 200  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
898412 cacaaccaaggtcggttttacctgaattttgacatagag--gtgccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaata 898509  T
201 attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat 300  Q
898510 attatgcacatactctgtctcttctgaatcattgaaaccttggtcctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcat 898609  T
301 taaagtttacacaacatctcgtctttgatgtcactctctgagattttcttcgac 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
898610 taaagtttacacaacatctcgtctttgatgtcactctctgagattttgttcgac 898663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 148993 times since January 2019
Visitors: 1515