View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_13 (Length: 339)

Name: NF1565_low_13
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_13
NF1565_low_13
[»] chr7 (2 HSPs)
chr7 (1-293)||(7375673-7375950)
chr7 (1-133)||(7278029-7278166)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 7375673 - 7375950
Alignment:
1 atgccaaacacagacataatggtttcatttgatgacttttgctttctttaatgatcttgtttttgtaatgaattt-gtt--ctctcaatcatgtgtttat 97  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||| |||  |||||||||||||||||||    
7375673 atgccaaacacagacataatggttgcatttgatgacttttgctttgtttaatgatcttgtctttgtaatgaattttgttgtctctcaatcatgtgtttat 7375772  T
98 tgtgatcaatgtaactaacttcaatgaaagtggcttccaaactctcttgacaagtgatggatcataaaattcagccaacagcaaagtaactgttgaggtt 197  Q
    |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |            
7375773 tgtgatcaatgtaactaacttcaaagaaagtggcttccaaattctcttgacaagtgatggatcataaaattcagccaacagcaaagtaacag-------- 7375864  T
198 ttcaattattcaaatatagtgctacagattacaacttcatattaaaaattacgtctcatttttgtgtattcagcttgataatatcaaataaatgat 293  Q
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
7375865 ----------caaatatagtgctacagattacaacttcatattaaaaactacgtctcatttttgtgtattcagcttgataatatcaaataaatgat 7375950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 7278166 - 7278029
Alignment:
1 atgccaaacacagacataatggtttcatttgatgacttttgctttctttaatgatcttgtttttgtaatgaa-tttgt--tctctcaatcatgtgtttat 97  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||| |||||  ||||||||||||||||||||    
7278166 atgccaaacacagacataatggttgcatttgatgacttttgctttgtttaatgatcttgtctttgtaatgaattttgttgtctctcaatcatgtgtttat 7278067  T
98 tgtg--atcaatgtaactaacttcaatgaaagtggctt 133  Q
    ||||  |||| |||||||||||||||||||||||||||    
7278066 tgtgatatcagtgtaactaacttcaatgaaagtggctt 7278029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137507 times since January 2019
Visitors: 1448