View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_15 (Length: 321)

Name: NF1565_low_15
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_15
NF1565_low_15
[»] chr7 (37 HSPs)
chr7 (7-118)||(14108829-14108940)
chr7 (7-118)||(14418786-14418897)
chr7 (121-237)||(45087067-45087183)
chr7 (119-237)||(45088192-45088310)
chr7 (116-237)||(45596866-45596988)
chr7 (110-176)||(21709149-21709215)
chr7 (29-116)||(40930653-40930740)
chr7 (120-176)||(26024888-26024944)
chr7 (117-176)||(21710602-21710661)
chr7 (29-116)||(38406266-38406350)
chr7 (29-69)||(4167785-4167825)
chr7 (114-178)||(19069951-19070015)
chr7 (118-178)||(36701357-36701417)
chr7 (110-178)||(40852159-40852227)
chr7 (119-178)||(23350915-23350974)
chr7 (115-178)||(24733625-24733688)
chr7 (70-116)||(4167700-4167746)
chr7 (110-172)||(19543481-19543543)
chr7 (116-178)||(39143510-39143572)
chr7 (116-178)||(48095361-48095423)
chr7 (117-178)||(3217753-3217814)
chr7 (117-178)||(7776956-7777017)
chr7 (117-178)||(8736123-8736184)
chr7 (119-176)||(10986695-10986752)
chr7 (117-178)||(13965038-13965099)
chr7 (119-160)||(26025883-26025924)
chr7 (117-178)||(27284240-27284301)
chr7 (119-172)||(39383805-39383858)
chr7 (119-172)||(40738193-40738246)
chr7 (117-178)||(45057539-45057600)
chr7 (117-178)||(47987325-47987386)
chr7 (110-178)||(19105598-19105666)
chr7 (118-178)||(20493744-20493804)
chr7 (118-178)||(31852081-31852141)
chr7 (118-178)||(36701739-36701799)
chr7 (118-178)||(37374456-37374516)
chr7 (118-178)||(45456733-45456793)
[»] scaffold0029 (2 HSPs)
scaffold0029 (119-237)||(71769-71887)
scaffold0029 (118-237)||(70668-70788)
[»] scaffold0394 (1 HSPs)
scaffold0394 (117-232)||(14268-14384)
[»] chr3 (31 HSPs)
chr3 (116-232)||(27688483-27688599)
chr3 (117-232)||(27695520-27695635)
chr3 (117-209)||(20184446-20184538)
chr3 (118-232)||(20185758-20185872)
chr3 (121-235)||(39991507-39991620)
chr3 (110-176)||(39992495-39992561)
chr3 (108-176)||(21815897-21815965)
chr3 (117-178)||(49221505-49221566)
chr3 (120-176)||(21817401-21817457)
chr3 (111-178)||(45940679-45940746)
chr3 (117-178)||(12061622-12061683)
chr3 (117-178)||(18024916-18024977)
chr3 (114-178)||(12739959-12740023)
chr3 (116-172)||(32304229-32304285)
chr3 (109-172)||(13355165-13355228)
chr3 (117-176)||(14859134-14859193)
chr3 (111-170)||(22976973-22977032)
chr3 (119-178)||(38771617-38771676)
chr3 (119-178)||(40503731-40503790)
chr3 (108-178)||(17934081-17934151)
chr3 (114-171)||(966975-967032)
chr3 (192-237)||(5348837-5348881)
chr3 (115-172)||(13301961-13302018)
chr3 (115-172)||(13312617-13312674)
chr3 (115-172)||(19794780-19794837)
chr3 (117-178)||(24242996-24243057)
chr3 (117-178)||(28004264-28004325)
chr3 (119-176)||(43464812-43464869)
chr3 (117-178)||(51891299-51891360)
chr3 (138-178)||(8327766-8327806)
chr3 (122-178)||(31049077-31049133)
[»] chr6 (35 HSPs)
chr6 (118-232)||(29751085-29751199)
chr6 (119-232)||(29744781-29744894)
chr6 (117-227)||(14403686-14403796)
chr6 (117-176)||(21611913-21611972)
chr6 (29-114)||(33801796-33801882)
chr6 (118-176)||(21282816-21282874)
chr6 (119-176)||(5660192-5660249)
chr6 (121-176)||(5659106-5659162)
chr6 (115-158)||(21283922-21283965)
chr6 (125-176)||(21612882-21612933)
chr6 (116-178)||(8938883-8938945)
chr6 (108-178)||(19048233-19048303)
chr6 (113-178)||(8286689-8286754)
chr6 (119-178)||(3618781-3618840)
chr6 (111-178)||(5645865-5645932)
chr6 (115-178)||(8286307-8286370)
chr6 (117-172)||(12260444-12260499)
chr6 (119-178)||(18700401-18700460)
chr6 (119-178)||(26841605-26841664)
chr6 (119-172)||(5645546-5645599)
chr6 (117-178)||(6888781-6888842)
chr6 (113-178)||(21272118-21272183)
chr6 (117-178)||(26392844-26392905)
chr6 (118-151)||(29465754-29465787)
chr6 (119-172)||(31038321-31038374)
chr6 (109-178)||(32223834-32223903)
chr6 (114-178)||(3366493-3366557)
chr6 (114-178)||(12261489-12261553)
chr6 (114-178)||(13703376-13703440)
chr6 (118-178)||(17383734-17383794)
chr6 (122-178)||(18693635-18693691)
chr6 (119-171)||(29467291-29467343)
chr6 (118-178)||(30859919-30859979)
chr6 (118-178)||(31038761-31038821)
chr6 (118-178)||(31739914-31739974)
[»] chr4 (45 HSPs)
chr4 (117-237)||(51645912-51646031)
chr4 (114-237)||(11038572-11038695)
chr4 (114-178)||(36220599-36220663)
chr4 (114-237)||(36219402-36219524)
chr4 (29-116)||(52980233-52980319)
chr4 (118-176)||(756486-756544)
chr4 (119-237)||(11039672-11039788)
chr4 (119-176)||(702651-702708)
chr4 (119-176)||(770950-771007)
chr4 (119-176)||(35060454-35060511)
chr4 (117-176)||(16038273-16038332)
chr4 (118-176)||(35055332-35055390)
chr4 (119-176)||(701633-701690)
chr4 (119-176)||(769932-769989)
chr4 (117-176)||(757500-757559)
chr4 (121-176)||(16039679-16039734)
chr4 (59-116)||(11094773-11094830)
chr4 (123-205)||(50551386-50551468)
chr4 (29-118)||(39592069-39592159)
chr4 (108-178)||(52766142-52766212)
chr4 (118-178)||(36611041-36611101)
chr4 (111-178)||(41845493-41845560)
chr4 (118-178)||(19630762-19630822)
chr4 (118-178)||(25764361-25764421)
chr4 (118-178)||(31208493-31208553)
chr4 (119-178)||(34237946-34238005)
chr4 (117-172)||(40681506-40681561)
chr4 (109-171)||(2735607-2735669)
chr4 (116-178)||(20614615-20614677)
chr4 (108-178)||(31487967-31488037)
chr4 (132-178)||(52766286-52766332)
chr4 (116-178)||(55014033-55014095)
chr4 (108-178)||(56271215-56271285)
chr4 (117-178)||(9203558-9203619)
chr4 (117-178)||(9207777-9207838)
chr4 (118-178)||(11649503-11649564)
chr4 (117-178)||(32617596-32617657)
chr4 (117-178)||(42369508-42369569)
chr4 (188-237)||(51644805-51644854)
chr4 (118-178)||(1098052-1098112)
chr4 (118-178)||(17475882-17475942)
chr4 (118-178)||(25618435-25618495)
chr4 (118-178)||(27509632-27509692)
chr4 (110-158)||(39899502-39899550)
chr4 (118-178)||(41610126-41610186)
[»] chr1 (40 HSPs)
chr1 (119-237)||(46015797-46015915)
chr1 (117-237)||(33332175-33332295)
chr1 (122-237)||(33333352-33333467)
chr1 (112-237)||(46014694-46014819)
chr1 (134-237)||(2939730-2939833)
chr1 (119-176)||(51597961-51598018)
chr1 (118-176)||(16962009-16962067)
chr1 (110-176)||(50682588-50682654)
chr1 (119-176)||(51599434-51599491)
chr1 (119-176)||(16963427-16963484)
chr1 (119-227)||(2938567-2938670)
chr1 (117-178)||(7964111-7964172)
chr1 (114-178)||(6327936-6328000)
chr1 (114-178)||(6328329-6328393)
chr1 (114-178)||(34023573-34023637)
chr1 (116-172)||(36143140-36143196)
chr1 (118-178)||(46448740-46448800)
chr1 (29-65)||(52742743-52742779)
chr1 (119-178)||(7965509-7965568)
chr1 (119-178)||(10579674-10579733)
chr1 (119-178)||(11652876-11652935)
chr1 (119-178)||(24326582-24326641)
chr1 (119-170)||(39202965-39203016)
chr1 (111-178)||(44114517-44114584)
chr1 (108-178)||(37483043-37483113)
chr1 (117-178)||(3798709-3798770)
chr1 (115-172)||(6714708-6714765)
chr1 (117-178)||(7334927-7334988)
chr1 (117-178)||(31488023-31488084)
chr1 (117-178)||(37483542-37483603)
chr1 (117-178)||(38980053-38980114)
chr1 (108-169)||(48222496-48222557)
chr1 (59-116)||(52742786-52742843)
chr1 (118-178)||(3798323-3798383)
chr1 (118-178)||(14244559-14244619)
chr1 (118-178)||(17738665-17738725)
chr1 (118-178)||(24370114-24370174)
chr1 (118-178)||(45678711-45678771)
chr1 (118-178)||(48225393-48225453)
chr1 (118-178)||(50227913-50227973)
[»] chr8 (53 HSPs)
chr8 (117-237)||(9311019-9311139)
chr8 (108-236)||(9312117-9312245)
chr8 (119-237)||(14816570-14816687)
chr8 (119-237)||(14829053-14829170)
chr8 (117-176)||(39567061-39567120)
chr8 (118-176)||(39270795-39270853)
chr8 (120-176)||(45378549-45378605)
chr8 (121-176)||(44633775-44633830)
chr8 (117-156)||(14819391-14819430)
chr8 (121-176)||(39568509-39568564)
chr8 (111-173)||(44632698-44632760)
chr8 (109-178)||(29802150-29802219)
chr8 (35-116)||(7486326-7486408)
chr8 (29-116)||(41522488-41522588)
chr8 (117-178)||(4325973-4326034)
chr8 (109-178)||(5822024-5822093)
chr8 (107-172)||(43633111-43633176)
chr8 (118-178)||(5876835-5876895)
chr8 (112-172)||(12823259-12823319)
chr8 (118-178)||(21524656-21524716)
chr8 (118-178)||(45467436-45467496)
chr8 (117-176)||(10134606-10134665)
chr8 (117-172)||(29802576-29802631)
chr8 (111-178)||(31445661-31445728)
chr8 (117-176)||(36194937-36194996)
chr8 (119-170)||(45377427-45377478)
chr8 (132-178)||(162415-162461)
chr8 (112-178)||(2221965-2222031)
chr8 (112-178)||(11760914-11760980)
chr8 (117-178)||(3318037-3318098)
chr8 (117-178)||(7116470-7116531)
chr8 (117-178)||(9807279-9807340)
chr8 (117-178)||(11713198-11713259)
chr8 (117-178)||(12849962-12850023)
chr8 (119-172)||(13463153-13463206)
chr8 (109-178)||(18476071-18476140)
chr8 (117-178)||(33098969-33099030)
chr8 (118-178)||(41836492-41836553)
chr8 (114-178)||(162662-162726)
chr8 (118-178)||(2221593-2221653)
chr8 (108-172)||(7041957-7042021)
chr8 (118-178)||(10398697-10398757)
chr8 (118-178)||(11901494-11901554)
chr8 (118-178)||(14054787-14054847)
chr8 (118-178)||(22013461-22013521)
chr8 (118-178)||(26060105-26060165)
chr8 (112-176)||(31933581-31933645)
chr8 (118-178)||(31988513-31988573)
chr8 (118-178)||(41155013-41155073)
chr8 (117-169)||(41387560-41387612)
chr8 (118-178)||(45123219-45123279)
chr8 (110-170)||(45466300-45466360)
chr8 (118-178)||(45467808-45467868)
[»] chr2 (38 HSPs)
chr2 (117-226)||(7184879-7184989)
chr2 (118-176)||(36889748-36889806)
chr2 (118-178)||(36888337-36888397)
chr2 (120-237)||(13809426-13809542)
chr2 (111-236)||(13810521-13810644)
chr2 (117-209)||(35738361-35738453)
chr2 (117-178)||(7031803-7031864)
chr2 (109-178)||(7032155-7032224)
chr2 (117-178)||(27516157-27516218)
chr2 (29-65)||(7983472-7983508)
chr2 (118-178)||(26892463-26892523)
chr2 (118-178)||(26897902-26897962)
chr2 (114-178)||(32194828-32194892)
chr2 (117-176)||(34166841-34166901)
chr2 (111-178)||(15130053-15130120)
chr2 (119-178)||(31557091-31557150)
chr2 (119-178)||(34618521-34618580)
chr2 (111-178)||(35251488-35251555)
chr2 (117-172)||(38578187-38578242)
chr2 (118-172)||(19297526-19297580)
chr2 (132-178)||(30785836-30785882)
chr2 (132-178)||(31309646-31309692)
chr2 (119-172)||(3603504-3603557)
chr2 (117-178)||(4602816-4602877)
chr2 (70-111)||(7983526-7983567)
chr2 (113-178)||(11131183-11131248)
chr2 (118-171)||(15044738-15044791)
chr2 (117-178)||(18904597-18904658)
chr2 (117-178)||(27516540-27516601)
chr2 (115-172)||(28190493-28190550)
chr2 (113-178)||(28958114-28958179)
chr2 (117-178)||(31309766-31309827)
chr2 (117-178)||(36099291-36099352)
chr2 (118-178)||(3124327-3124387)
chr2 (118-178)||(7182698-7182758)
chr2 (114-178)||(30786025-30786089)
chr2 (114-178)||(35589165-35589229)
chr2 (111-171)||(45001045-45001105)
[»] chr5 (32 HSPs)
chr5 (117-237)||(19718830-19718950)
chr5 (117-178)||(4959559-4959620)
chr5 (117-178)||(11079629-11079690)
chr5 (109-178)||(19798719-19798788)
chr5 (117-178)||(22803589-22803650)
chr5 (117-178)||(37812229-37812290)
chr5 (117-178)||(42026663-42026724)
chr5 (118-178)||(1155963-1156023)
chr5 (29-65)||(7426954-7426990)
chr5 (118-178)||(30112709-30112769)
chr5 (114-178)||(42026278-42026342)
chr5 (119-178)||(4349495-4349554)
chr5 (119-178)||(4349874-4349933)
chr5 (119-178)||(6172340-6172399)
chr5 (119-178)||(9040743-9040802)
chr5 (119-178)||(9438237-9438296)
chr5 (115-178)||(11079124-11079187)
chr5 (119-178)||(24100267-24100326)
chr5 (119-178)||(31369926-31369985)
chr5 (119-178)||(42382172-42382231)
chr5 (70-116)||(7426890-7426936)
chr5 (114-172)||(8127467-8127525)
chr5 (116-178)||(16670027-16670089)
chr5 (116-178)||(43476437-43476499)
chr5 (117-178)||(435552-435613)
chr5 (117-178)||(6157496-6157557)
chr5 (117-178)||(16791969-16792030)
chr5 (117-178)||(21289529-21289590)
chr5 (118-171)||(25333194-25333247)
chr5 (121-178)||(37812550-37812607)
chr5 (118-178)||(17339794-17339854)
chr5 (118-178)||(24100699-24100759)
[»] scaffold0194 (2 HSPs)
scaffold0194 (118-178)||(19244-19304)
scaffold0194 (121-178)||(18070-18127)
[»] scaffold0031 (3 HSPs)
scaffold0031 (108-176)||(129420-129488)
scaffold0031 (117-176)||(123422-123481)
scaffold0031 (117-176)||(134298-134357)
[»] scaffold0025 (1 HSPs)
scaffold0025 (59-116)||(56508-56565)
[»] scaffold0295 (1 HSPs)
scaffold0295 (118-178)||(8215-8275)
[»] scaffold0006 (1 HSPs)
scaffold0006 (118-178)||(83385-83445)
[»] scaffold0005 (1 HSPs)
scaffold0005 (114-178)||(1470-1534)
[»] scaffold0352 (1 HSPs)
scaffold0352 (112-178)||(11423-11489)
[»] scaffold0220 (1 HSPs)
scaffold0220 (119-176)||(25963-26020)
[»] scaffold0135 (6 HSPs)
scaffold0135 (117-178)||(5856-5917)
scaffold0135 (117-178)||(10071-10132)
scaffold0135 (117-178)||(14286-14347)
scaffold0135 (117-178)||(18501-18562)
scaffold0135 (117-178)||(22716-22777)
scaffold0135 (117-178)||(26931-26992)
[»] scaffold0054 (2 HSPs)
scaffold0054 (117-178)||(57020-57081)
scaffold0054 (118-178)||(57557-57617)
[»] scaffold0026 (1 HSPs)
scaffold0026 (117-178)||(99979-100040)
[»] scaffold0017 (1 HSPs)
scaffold0017 (121-178)||(172910-172967)
[»] scaffold0014 (1 HSPs)
scaffold0014 (118-178)||(230871-230931)
[»] scaffold0012 (1 HSPs)
scaffold0012 (118-178)||(144717-144777)
[»] scaffold0009 (1 HSPs)
scaffold0009 (114-178)||(242160-242224)
[»] scaffold0002 (1 HSPs)
scaffold0002 (114-162)||(429163-429211)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 37)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 14108829 - 14108940
Alignment:
7 ggaacagagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14108829 ggaacaaagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 14108928  T
107 caataaaatata 118  Q
    ||||||||||||    
14108929 caataaaatata 14108940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 14418786 - 14418897
Alignment:
7 ggaacagagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14418786 ggaacaaagatgagaataaagattttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgttta 14418885  T
107 caataaaatata 118  Q
    ||||||||||||    
14418886 caataaaatata 14418897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 45087067 - 45087183
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttac 220  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
45087067 cttaattgttattttagtcctttaactaattttttggtatcggtttggtcccataactaaaaaaaggtccgttttggtattttaacttttgctccgttac 45087166  T
221 atgttttagtcctttcc 237  Q
    ||||||| ||| |||||    
45087167 atgttttggtcttttcc 45087183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 45088310 - 45088192
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||       ||||||||||||||||||||||||||||| |||    
45088310 ggcttaattgctattttagtcccttaactaattgtttggtatcagtttggtcccataactaaaaaaaggtccgttttggtattttaacttttgctcagtt 45088211  T
219 acatgttttagtcctttcc 237  Q
    || |||||| |||||||||    
45088210 acttgttttggtcctttcc 45088192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 116 - 237
Target Start/End: Original strand, 45596866 - 45596988
Alignment:
116 ataggcttaattgctattttagtcccttaactaa-ttttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctc 214  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||||| |  |||||||        ||||||||||||||||||| |||  |||    
45596866 ataggcttaattgctattttaatcccttaactaatttttttggtatcggtttgataacataactaaaaaaaagtccgttttggtattttaagtttatctc 45596965  T
215 cgttacatgttttagtcctttcc 237  Q
    | ||||||||||| |||||||||    
45596966 cattacatgttttggtcctttcc 45596988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 21709149 - 21709215
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||    
21709149 taaaatttaggcttaattgctattttcgtcccttaactaattttttagtatcgctttggtcccataa 21709215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 40930740 - 40930653
Alignment:
29 ttttaggaatgattatgttgatgaagat-taagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||||||||||||||||||||||||   ||||||| |||||||||||||||||||||| | ||||||||| ||||| |||||||||    
40930740 ttttaggaatgattatgttgatgaagataggagaagaagatgaagaaaggtgagaaaaata-taagtgttggtggtttataataaaata 40930653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 26024888 - 26024944
Alignment:
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||| || ||||||||||| |||||||||||||| |||||||||||||    
26024888 gcttaattgctatcttcgtcccttaacttattttttggtatcgctttggtcccataa 26024944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 21710661 - 21710602
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| ||||| |||||| ||||||||||| |||||||||||||| |||||||||||||    
21710661 taggctgaattgatatttttgtcccttaacttattttttggtatcgctttggtcccataa 21710602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 38406350 - 38406266
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||| |||||||  |||||||| |||||||   |||||||||||||| ||||||||| |||| | | |||||||||||||||    
38406350 ttttaggaataattatgtccatgaagatgaagaaga---tgaagaaaggtgaggaaaatatttggtgtggatggtttacaataaaata 38406266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 4167825 - 4167785
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaaaatg 69  Q
    |||||||||||||||||||||||||||| ||||||||||||    
4167825 ttttaggaatgattatgttgatgaagatgaagaagaaaatg 4167785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 19070015 - 19069951
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||| ||  ||||||||| |||||    
19070015 atataggcttaattacttttttggtcccttaacttattttttggtttcattttggtcccttaact 19069951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36701357 - 36701417
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
36701357 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 36701417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 40852227 - 40852159
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
40852227 taaaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 40852159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 23350915 - 23350974
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||  ||||||||||||||| |||||||||| ||| ||||||||| |||||    
23350915 ggcttaattactcatttagtcccttaacttattttttggtttcgttttggtcccttaact 23350974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 24733625 - 24733688
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24733625 tataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24733688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 116
Target Start/End: Complemental strand, 4167746 - 4167700
Alignment:
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||  |||| ||| |||||||||||||||    
4167746 aagaaaggtgagaaaaatattaggtgtcggtggtttacaataaaata 4167700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 172
Target Start/End: Original strand, 19543481 - 19543543
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||  ||||||||||||||| |||||||||||| || ||| |||||| |||| ||||    
19543481 taaaatataaacttaattgctattttcgtcccttaactatttatttagtatcgctttgatccc 19543543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 39143572 - 39143510
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
39143572 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 39143510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 48095423 - 48095361
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
48095423 ataggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 48095361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3217814 - 3217753
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3217814 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3217753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 7777017 - 7776956
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7777017 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 7776956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 8736184 - 8736123
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
8736184 taggcttaattactcttttggtcccttaatttattttttggtgtcgttttggtcccttaact 8736123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 10986695 - 10986752
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| || |||| |||||||||||| ||||||||||||| |||| ||| ||||    
10986695 ggcttaatttctcttttcgtcccttaactatttttttggtatcgttttgctcctataa 10986752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 13965038 - 13965099
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
13965038 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 13965099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 160
Target Start/End: Complemental strand, 26025924 - 26025883
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtat 160  Q
    ||||||||||||||||| |||| ||||||||||| |||||||    
26025924 ggcttaattgctatttttgtcctttaactaatttcttggtat 26025883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 27284240 - 27284301
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
27284240 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 27284301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 39383805 - 39383858
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
39383805 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 39383858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 40738193 - 40738246
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||||| |||||| ||||||||  || |||||| |||||||||    
40738193 ggcttaattgctattttcgtccctcaactaattaattagtatcgctttggtccc 40738246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 45057539 - 45057600
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
45057539 taggcttaattactcttttggtcccttaacttattttttggtttcgttttgatcccttaact 45057600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 47987325 - 47987386
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
47987325 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 47987386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 19105666 - 19105598
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||||||||||||| || |||| ||||||||||| |||||||| | ||  ||||||||| |||||    
19105666 taaattataggcttaattactcttttggtcccttaacttattttttgatttcattttggtcccttaact 19105598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 20493744 - 20493804
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
20493744 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 20493804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31852141 - 31852081
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31852141 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31852081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 36701799 - 36701739
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
36701799 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 36701739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 37374516 - 37374456
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37374516 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37374456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45456733 - 45456793
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45456733 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45456793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 71887 - 71769
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||       |||||||| ||||||||||||||||||||||||    
71887 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccataactaaaaaaaggtccgttgtggtattttaacttttgctccgtt 71788  T
219 acatgttttagtcctttcc 237  Q
    ||||||||| |||||||||    
71787 acatgttttggtcctttcc 71769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 118 - 237
Target Start/End: Original strand, 70668 - 70788
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact-nnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||| ||||||||||||||||||| |||||    
70668 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactaaaaaaaaagtccattttggtattttaacttttactccg 70767  T
217 ttacatgttttagtcctttcc 237  Q
    ||||||||||| |||||||||    
70768 ttacatgttttggtcctttcc 70788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0394 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0394
Description:

Target: scaffold0394; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 117 - 232
Target Start/End: Original strand, 14268 - 14384
Alignment:
117 taggcttaattgctattttagtcccttaactaa-ttttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||    
14268 taggcttaattgctattttagtcccttaactaatttttttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttcc 14367  T
216 gttacatgttttagtcc 232  Q
    |||||||||||||||||    
14368 gttacatgttttagtcc 14384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 31)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 116 - 232
Target Start/End: Original strand, 27688483 - 27688599
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||    
27688483 ataggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttcc 27688582  T
216 gttacatgttttagtcc 232  Q
    |||||||||||| ||||    
27688583 gttacatgttttggtcc 27688599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 117 - 232
Target Start/End: Complemental strand, 27695635 - 27695520
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| ||||    
27695635 taggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactgaaaaaaagtccgttttggtattttaacttttgttccg 27695536  T
217 ttacatgttttagtcc 232  Q
    ||||||||||| ||||    
27695535 ttacatgttttggtcc 27695520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 20184446 - 20184538
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttt 209  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
20184446 taggcttaattgttattttagtcccttaactaattttttggtatcggtttggtcccataactaaaaataaatccgttttggtattttaacttt 20184538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 118 - 232
Target Start/End: Complemental strand, 20185872 - 20185758
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgt 217  Q
    ||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||||||||        ||  ||||||||||||||||||||| |||||    
20185872 aggcttaattgctattttagtccattacctaatttttttgtatcggtttgatcccataactaaaaaaaagtttgttttggtattttaacttttgttccgt 20185773  T
218 tacatgttttagtcc 232  Q
    |||||||||| ||||    
20185772 tacatgttttggtcc 20185758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 121 - 235
Target Start/End: Original strand, 39991507 - 39991620
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttac 220  Q
    |||||||| ||||||||| ||||||||||||||||| ||||| |||| ||||||||||         |||||||||||||||||||||||||||| | ||    
39991507 cttaattgttattttagttccttaactaattttttgatatcgttttgatcccataactaaaaaaaa-tccgttttggtattttaacttttgctccatcac 39991605  T
221 atgttttagtccttt 235  Q
    |||||||||||||||    
39991606 atgttttagtccttt 39991620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 39992561 - 39992495
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||  ||| |||||||||    
39992561 taaaatataggcttaattactattttagtcccttaactaattttttggtatcacttttgtcccataa 39992495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21815897 - 21815965
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||| |||| |||||||||||||||| ||||||||||||||||||| |||||| |||||| ||||||    
21815897 aataaattataagcttaattgctattttcgtcccttaactaattttttagtatcgctttggttccataa 21815965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 49221505 - 49221566
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||||||| |||||| ||||||||||||||||||||||||||| || |||||||||||    
49221505 taggtttaattgttatttttgtcccttaactaattttttggtatcgggttagtcccataact 49221566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 21817457 - 21817401
Alignment:
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||| |||||||  ||||||||||||||||||||||||| |||||||||||||    
21817457 gcttaattactattttcatcccttaactaattttttggtatcgctttggtcccataa 21817401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 45940746 - 45940679
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45940746 aaaatttaggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 45940679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 12061622 - 12061683
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
12061622 taggcttaattactcttttggtcccttaacttattttttggtgtcgttttggtcccttaact 12061683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 18024977 - 18024916
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||| ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18024977 taggcttaattactaatttggtcccttaacttattttttggtttcgttttggtcccttaact 18024916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 12739959 - 12740023
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
12739959 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 12740023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 172
Target Start/End: Original strand, 32304229 - 32304285
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
32304229 ataggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 32304285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 109 - 172
Target Start/End: Original strand, 13355165 - 13355228
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||| |||||||||| || | ||||||||||||||||| ||  ||||||||| |||||||||    
13355165 ataaaaaataggcttaaatgttcttttagtcccttaactatttaattggtatcgctttggtccc 13355228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 14859193 - 14859134
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||||  |||||||| || |||||| |||||| |||||| ||||||    
14859193 taggcttaattgctattttcttcccttaaatatttttttagtatcgctttggttccataa 14859134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 22976973 - 22977032
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    ||||||||||||||||| || |||| |||| |||||| |||||||||| ||| |||||||    
22976973 aaaatataggcttaattacttttttggtcctttaacttattttttggtttcgttttggtc 22977032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 38771676 - 38771617
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
38771676 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 38771617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 40503790 - 40503731
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
40503790 ggcttaattgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 40503731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Complemental strand, 17934151 - 17934081
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||  ||||||||| ||  ||||||||||||||| |||||||||| | | ||||||||| |||||    
17934151 aataaaataatggcttaattactcatttagtcccttaacttattttttggttttgttttggtcccttaact 17934081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 171
Target Start/End: Original strand, 966975 - 967032
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||    
966975 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcc 967032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 237
Target Start/End: Complemental strand, 5348881 - 5348837
Alignment:
192 ttttggtattttaacttttgctccgttacatgttttagtcctttcc 237  Q
    ||||||||||||||||||| ||||||||||| |||| |||||||||    
5348881 ttttggtattttaactttt-ctccgttacatattttggtcctttcc 5348837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 13302018 - 13301961
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||    
13302018 tataggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtccc 13301961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 13312674 - 13312617
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||    
13312674 tataggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtccc 13312617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 19794837 - 19794780
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||  || |||| ||||||||||| |||||||||| ||| |||||||||    
19794837 tataggcttaataactcttttggtcccttaacttattttttggtttcgttttggtccc 19794780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 24243057 - 24242996
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24243057 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24242996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 28004264 - 28004325
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
28004264 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 28004325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 43464812 - 43464869
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
43464812 ggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtcccataa 43464869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 51891360 - 51891299
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
51891360 taggtttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 51891299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 178
Target Start/End: Complemental strand, 8327806 - 8327766
Alignment:
138 tcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||||||||||||||||||| |||||    
8327806 tcccttaactatttatttggtatcggtttggtcccttaact 8327766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 31049133 - 31049077
Alignment:
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
31049133 ttaaatgcttttttagtcccttaactatttaattggtatcgctttggtcccttaact 31049077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 35)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 118 - 232
Target Start/End: Complemental strand, 29751199 - 29751085
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgt 217  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| |||||    
29751199 aggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgt 29751100  T
218 tacatgttttagtcc 232  Q
    |||||||||| ||||    
29751099 tacatgttttggtcc 29751085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 119 - 232
Target Start/End: Original strand, 29744781 - 29744894
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||        ||||||||||||||||||||||||| ||||||    
29744781 ggcttaattgctattttagtcccttaactaattatttggtatcggtttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgtt 29744880  T
219 acatgttttagtcc 232  Q
    ||||||||| ||||    
29744881 acatgttttggtcc 29744894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 117 - 227
Target Start/End: Original strand, 14403686 - 14403796
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| ||||||| ||||||||  |||||||||||||||       ||||| ||||||||||||||||||||| |||    
14403686 taggcttaattgctattttagtcccttacctaatttgttggtatcactttggtcccataactaaaatttggtccattttggtattttaacttttgcgccg 14403785  T
217 ttacatgtttt 227  Q
    |||||||||||    
14403786 ttacatgtttt 14403796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 21611913 - 21611972
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
21611913 taggcttaattgctattttcgtcccttaactaattttttggtatcgatttggtcccataa 21611972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 29 - 114
Target Start/End: Original strand, 33801796 - 33801882
Alignment:
29 ttttaggaatgattatgttgatgaagatta-agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaa 114  Q
    ||||||||||||||||||||||||||||   ||||||| |||||||||||||| ||||||||  ||||||||| ||||| |||||||    
33801796 ttttaggaatgattatgttgatgaagataggagaagaagatgaagaaaggtgaaaaaaatatcaagtgttggtggtttataataaaa 33801882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 21282816 - 21282874
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| ||||||||| ||||||||| |||||| |||||||||||||    
21282816 aggcttaattgctattttcgtcccttaattaatttttttgtatcgctttggtcccataa 21282874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 5660249 - 5660192
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||| ||||||||||||||||||| ||||||| |||||    
5660249 ggcttaattgctattttcgtccctaaactaattttttggtatcgttttggtctcataa 5660192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 5659106 - 5659162
Alignment:
121 cttaattgctatttta-gtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||  |||||||||||||||||||||||||  |||||||||||||    
5659106 cttaattgctatttttcgtcccttaactaattttttggtatcactttggtcccataa 5659162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 158
Target Start/End: Complemental strand, 21283965 - 21283922
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggt 158  Q
    |||||||||||||| |||||| ||||||||||||||||||||||    
21283965 tataggcttaattgttattttcgtcccttaactaattttttggt 21283922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 21612933 - 21612882
Alignment:
125 attgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||| |||||| ||||||||| |||||||||||||||| |||||||||||||    
21612933 attgttattttcgtcccttaattaattttttggtatcgttttggtcccataa 21612882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 8938883 - 8938945
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
8938883 ataggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 8938945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 19048233 - 19048303
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||||||||| || |||| ||||||||||| |||||||||| ||  ||||||||| |||||    
19048233 aataaaataaaggcttaattacttttttggtcccttaacttattttttggtttcattttggtcccttaact 19048303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 8286754 - 8286689
Alignment:
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||| || |||| | ||||||||| |||||||||| ||| ||||||||| |||||    
8286754 aatataggcttaattacttttttgggcccttaacttattttttggtttcgttttggtcccttaact 8286689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 3618781 - 3618840
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
3618781 ggcttaaatgcttttttagtcccttaactatttaattggtatcgctttggtcccttaact 3618840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 5645932 - 5645865
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
5645932 aaaataaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 5645865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 8286307 - 8286370
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| || |||| ||| ||||||| |||||||||| ||| ||||||||| |||||    
8286307 tataggcttaattactcttttggtctcttaacttattttttggtttcgttttggtcccttaact 8286370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 12260444 - 12260499
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
12260444 taggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 12260499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 18700401 - 18700460
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18700401 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 18700460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 26841664 - 26841605
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
26841664 ggcttaattactctttttgtcccttaacttattttttggtttcgttttggtcccttaact 26841605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 5645546 - 5645599
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
5645546 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 5645599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 6888781 - 6888842
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
6888781 taggcttaattactcttttggtcccttaatttattttttggtttcgttttggtcccttaact 6888842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 21272183 - 21272118
Alignment:
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| ||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
21272183 aatattggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 21272118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 26392905 - 26392844
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
26392905 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 26392844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 151
Target Start/End: Original strand, 29465754 - 29465787
Alignment:
118 aggcttaattgctattttagtcccttaactaatt 151  Q
    |||||||||||||||||| |||||||||||||||    
29465754 aggcttaattgctattttcgtcccttaactaatt 29465787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 31038321 - 31038374
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
31038321 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 31038374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Original strand, 32223834 - 32223903
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| ||| |||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
32223834 ataaaataaaggtttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 32223903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 3366493 - 3366557
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| ||||||||| ||| ||||| || ||  ||||||||| ||||||||| |||||    
3366493 atataggcttaaatgctattttggtctcttaattatttaattggtatcgctttggtcccttaact 3366557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 12261553 - 12261489
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||  |||| |||||||||||| || |||||||||  ||||||||| |||||    
12261553 atataggcttaaatgcgtttttggtcccttaactatttatttggtatcactttggtcccttaact 12261489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 13703376 - 13703440
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| |||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
13703376 atataagcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 13703440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 17383734 - 17383794
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17383734 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 17383794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 18693691 - 18693635
Alignment:
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
18693691 ttaattacttttttggtcccttaacttattttttggtttcgttttggtcccttaact 18693635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 171
Target Start/End: Complemental strand, 29467343 - 29467291
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||||||||||||||| |||||||||||| || ||| |||| | ||||||||    
29467343 ggcttaattgctattttcgtcccttaactatttatttagtattgctttggtcc 29467291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 30859919 - 30859979
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
30859919 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 30859979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31038821 - 31038761
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||||||||||||||| | |||||||| ||| |||||| || |||||    
31038821 aggcttaattactcttttagtcccttaacttaatttttggtttcgttttggttccttaact 31038761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31739974 - 31739914
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31739974 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31739914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 45)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 117 - 237
Target Start/End: Complemental strand, 51646031 - 51645912
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||        ||||||||||||||||||| |||  |||||    
51646031 taggcttaattgctattttagtcccttagctaattttttggtatcggtttggtcccataactaaaaaaa-gtccgttttggtattttaagtttatctccg 51645933  T
217 ttacatgttttagtcctttcc 237  Q
    ||||||||||| |||||||||    
51645932 ttacatgttttggtcctttcc 51645912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 11038572 - 11038695
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgct 213  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||        ||| ||||||||||||||||||||| |    
11038572 atattggcttaattgctattttagtcccttagctaattttttggtattgctttggtcccataactaaaaaaaagtctgttttggtattttaacttttgtt 11038671  T
214 ccgttacatgttttagtcctttcc 237  Q
    | ||| | |||||| |||||||||    
11038672 ctgtttcttgttttggtcctttcc 11038695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 36220663 - 36220599
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
36220663 atataggcttaattgctattttagtaccttaactaattttttggtatcgttttggtcccataact 36220599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 36219402 - 36219524
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgct 213  Q
    ||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||        ||||||||| ||||||||| |||  ||    
36219402 atatatgcttaattgctattttagtcccttaactaatttttgagtatcggtttggtcccataactaaaaaaa-gtccgttttagtattttaagtttatct 36219500  T
214 ccgttacatgttttagtcctttcc 237  Q
    ||||||||| |||| ||| |||||    
36219501 ccgttacatattttggtcatttcc 36219524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 52980319 - 52980233
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||||||||| || ||||| |  |||||||||||||||||||||  |||||||| |||||||||||||||    
52980319 ttttaggaatgattatgttgatgaagatgaaaaagaataa-aagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 52980233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 756486 - 756544
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
756486 aggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 756544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 11039788 - 11039672
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||  ||||||||||||||||||||  |||| ||  ||||||        |||| ||||||||||||||||||||||||||     
11039788 ggcttaattgctattttagtcatttaactaattttttggtatcactttgatc--ataactaaaaaaaagtccattttggtattttaacttttgctccgtc 11039691  T
219 acatgttttagtcctttcc 237  Q
    ||||||||||||| |||||    
11039690 acatgttttagtcatttcc 11039672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 702708 - 702651
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
702708 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 702651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 771007 - 770950
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
771007 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 770950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 35060511 - 35060454
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
35060511 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttggtcccataa 35060454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 16038273 - 16038332
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
16038273 taggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 16038332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 35055332 - 35055390
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
35055332 aggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 35055390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 701633 - 701690
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
701633 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 701690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 769932 - 769989
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
769932 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 769989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 757559 - 757500
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||||  |||||||||| |||||||||||||| |||||||||||||    
757559 taggcttaattgctattttcatcccttaacttattttttggtatcgctttggtcccataa 757500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 16039734 - 16039679
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| |||||||||||||||||||||||||| || ||||||||||    
16039734 cttaattgctatttttgtcccttaactaattttttggtatcgtttcggtcccataa 16039679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 59 - 116
Target Start/End: Complemental strand, 11094830 - 11094773
Alignment:
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  |||||||| |||||||||||||||    
11094830 agaagaagatgaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 11094773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 123 - 205
Target Start/End: Complemental strand, 50551468 - 50551386
Alignment:
123 taattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaa 205  Q
    |||||| |||||||||||||||| |||||||||||||||||||| || ||||||||        |||||||||||||||||||    
50551468 taattgttattttagtcccttaattaattttttggtatcggtttagttccataactaaaaaaaagtccgttttggtattttaa 50551386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 118
Target Start/End: Original strand, 39592069 - 39592159
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaaa-atgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaatata 118  Q
    |||||||||||||||||  ||||||||  || | | || | ||||||||||||||||||||||  |||||||| |||||||||||||||||    
39592069 ttttaggaatgattatgaagatgaagaagaatagggaagaagaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaatata 39592159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 52766142 - 52766212
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
52766142 aataaaatataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 52766212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36611041 - 36611101
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||||||||||||||| |||||||||| ||| ||||||||| |||||    
36611041 aggcttaattactcttttagtcccttaacttattttttggtttcgttttggtcccttaact 36611101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 41845493 - 41845560
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||||||  ||||||||| ||||||||| |||||    
41845493 aaaaaataggcttaaatgctcttttggtcccttaactaattaattggtatcgctttggtcccttaact 41845560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 19630762 - 19630822
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
19630762 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 19630822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 25764361 - 25764421
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
25764361 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 25764421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 31208553 - 31208493
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
31208553 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 31208493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 34238005 - 34237946
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
34238005 ggcttaaatgctattttggtcccttaactatttaattggtatcgttttggtcccttaact 34237946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 40681561 - 40681506
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
40681561 taggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 40681506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 2735669 - 2735607
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||| ||||||||||| |||| |||| ||||||||| || || |||||||||| ||||||||    
2735669 ataaattataggcttaaatgctcttttggtcccttaaatatttatttggtatcgctttggtcc 2735607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 20614677 - 20614615
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
20614677 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 20614615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 31487967 - 31488037
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| | ||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31487967 aataaaatttgggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31488037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 52766286 - 52766332
Alignment:
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
52766286 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 52766332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 55014095 - 55014033
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || ||||||||| |||||| |||||||||| ||| |||||| || |||||    
55014095 ataggcttaattactcttttagtccattaacttattttttggtttcgttttggtaccttaact 55014033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Complemental strand, 56271285 - 56271215
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| ||| ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
56271285 aatataatctaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 56271215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9203619 - 9203558
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
9203619 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 9203558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9207838 - 9207777
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
9207838 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 9207777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 11649503 - 11649564
Alignment:
118 aggcttaattgctattttagtcccttaactaattt-tttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||||||||||||||||||||  ||||||||| ||||| ||| |||||    
11649503 aggcttaaatgctcttttagtcccttaactaatttaattggtatcgctttggacccttaact 11649564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 32617657 - 32617596
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
32617657 taggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 32617596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 42369569 - 42369508
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
42369569 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 42369508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 51644805 - 51644854
Alignment:
188 tccgttttggtattttaacttttgctccgttacatgttttagtcctttcc 237  Q
    |||||||||||||||||| |||  || ||||||||||||| |||||||||    
51644805 tccgttttggtattttaagtttatcttcgttacatgttttggtcctttcc 51644854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 1098052 - 1098112
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
1098052 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 1098112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 17475942 - 17475882
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17475942 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 17475882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 25618435 - 25618495
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
25618435 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 25618495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 27509632 - 27509692
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
27509632 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 27509692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 158
Target Start/End: Complemental strand, 39899550 - 39899502
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggt 158  Q
    ||||| |||||||||||| || |||| ||||||||||| ||||||||||    
39899550 taaaaaataggcttaattactcttttggtcccttaacttattttttggt 39899502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 41610126 - 41610186
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
41610126 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 41610186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 40)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 46015915 - 46015797
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||        ||||||||||||||||||||||||| ||||||    
46015915 ggcttaattgttattttagtcccttaagtaattttttggtatcgctttggtcccataactaaaaaaaagtccgttttggtattttaacttttgttccgtt 46015816  T
219 acatgttttagtcctttcc 237  Q
     | ||||||||||||||||    
46015815 tcttgttttagtcctttcc 46015797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 117 - 237
Target Start/End: Original strand, 33332175 - 33332295
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    ||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||        |||||||||| |||||||||||||||||||    
33332175 taggcttaattgctattttagtctcttaactagttgtttggtatcggtttggtcccataactaaaaaaatgtccgttttgatattttaacttttgctccg 33332274  T
217 ttacatgttttagtcctttcc 237  Q
    |||| |||||| ||| |||||    
33332275 ttacttgttttggtcatttcc 33332295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 33333467 - 33333352
Alignment:
122 ttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttaca 221  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |        ||||||||||||||||||| |||||||||||||||    
33333467 ttaattgctattttagtcccttaactaattttttggtatcagtttggtcccataattaaaaaaatgtccgttttggtattttaatttttgctccgttaca 33333368  T
222 tgttttagtcctttcc 237  Q
    | |||| ||| |||||    
33333367 tcttttggtcatttcc 33333352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 112 - 237
Target Start/End: Original strand, 46014694 - 46014819
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttg 211  Q
    |||| |||||||||||||||||||||||  ||||||||||||||||||||| || | ||||||||||        ||| |||||||||||||||||||||    
46014694 aaatgtaggcttaattgctattttagtcatttaactaattttttggtatcgcttcgatcccataactaaaaaaaagtctgttttggtattttaacttttg 46014793  T
212 ctccgttacatgttttagtcctttcc 237  Q
    ||| || |||||||||||||||||||    
46014794 ctctgtcacatgttttagtcctttcc 46014819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 237
Target Start/End: Complemental strand, 2939833 - 2939730
Alignment:
134 ttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgttacatgttttagtcct 233  Q
    ||||||||||||||||| |||||||||||||||||||| ||||||        ||| |||||||||||||||||||||||||||||| |||||| ||| |    
2939833 ttagtcccttaactaatattttggtatcggtttggtcctataactaaaaaaatgtctgttttggtattttaacttttgctccgttacttgttttggtcat 2939734  T
234 ttcc 237  Q
    ||||    
2939733 ttcc 2939730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 51597961 - 51598018
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
51597961 ggcttaattgctattttcgtcccttaacttattttttggtatcgctttggtcccataa 51598018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 16962009 - 16962067
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| |||||||||||||||||||||||| | |||||||| ||||    
16962009 aggcttaattgctatttttgtcccttaactaattttttggtattgctttggtcctataa 16962067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 50682654 - 50682588
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||| ||| |||||||||||||||| ||||||||| || ||||||||||||| |||||||||||||    
50682654 taaaaaataagcttaattgctattttggtcccttaattatttttttggtatcgctttggtcccataa 50682588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 51599491 - 51599434
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||| ||| ||||    
51599491 ggcttaattgctattttcgtcccttaactaattttttggtatcgctttgatcctataa 51599434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 16963484 - 16963427
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||| |||||| || ||||||||||||||||||||||| ||||||| |||||    
16963484 ggcttaattgttattttcgttccttaactaattttttggtatcgatttggtctcataa 16963427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 119 - 227
Target Start/End: Original strand, 2938567 - 2938670
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||| |||||||||||||| ||||||||||| ||||||  ||||||||       |||||| |||  |||||||| ||||||||||||    
2938567 ggcttaattgctattt-agtcccttaactaa-tttttggtatcagtttgg--ccataactaaaaaaaggtccg-tttaatattttaatttttgctccgtt 2938661  T
219 acatgtttt 227  Q
    |||||||||    
2938662 acatgtttt 2938670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7964111 - 7964172
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
7964111 taggcttaaatgctcttttggtcccttaactatttatttggtatcgctttggtcccttaact 7964172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 6327936 - 6328000
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||  |||||||||||| ||  ||||||||| ||||||||| |||||    
6327936 atataggcttaattgctctttaggtcccttaactatttaattggtatcgctttggtcccttaact 6328000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 6328393 - 6328329
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||| ||||||||| || ||  ||||||||| ||||||||| |||||    
6328393 atataggcttaattgctcttttggtcccttaagtatttaattggtatcgctttggtcccttaact 6328329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 34023637 - 34023573
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
34023637 atataggtttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 34023573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 36143196 - 36143140
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
36143196 ataggcttaattgctcttttcgtcccttaagttattatttggtatcgatttggtccc 36143140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 46448800 - 46448740
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
46448800 aggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 46448740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 52742743 - 52742779
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
52742743 ttttaggaatgattatgttgatgaagatgaagaagaa 52742779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 7965568 - 7965509
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
7965568 ggcttaaatgctcttttggtcccttaactatttatttggtatcgttttggtcccttaact 7965509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 10579733 - 10579674
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
10579733 ggcttaattactcttttggtcccttaacttattttttggtttcgatttggtcccttaact 10579674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 11652876 - 11652935
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
11652876 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 11652935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 24326582 - 24326641
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| |||| |||||||||||| || |||||||||| ||||||||| |||||    
24326582 ggcttaaatgctcttttggtcccttaactatttatttggtatcgctttggtcccttaact 24326641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 39203016 - 39202965
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    |||||||||| ||||||||||| |||| |||||| ||||||||| |||||||    
39203016 ggcttaattgttattttagtcctttaattaatttgttggtatcgatttggtc 39202965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 44114584 - 44114517
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
44114584 aaaaaataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 44114517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 37483043 - 37483113
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| | |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37483043 aataaaaaaaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37483113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3798770 - 3798709
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3798770 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3798709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 6714765 - 6714708
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||||    
6714765 tataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtccc 6714708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 7334988 - 7334927
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7334988 taggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 7334927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 31488023 - 31488084
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31488023 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31488084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 37483603 - 37483542
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
37483603 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 37483542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 38980114 - 38980053
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
38980114 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 38980053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 48222557 - 48222496
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggt 169  Q
    ||||||||||||||| || |||| |||| ||||||||||||  ||||| ||||||| |||||    
48222557 aataaaatataggctaaagtgctcttttggtcccttaactatatttttagtatcggattggt 48222496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 116
Target Start/End: Original strand, 52742786 - 52742843
Alignment:
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  ||||  || ||||||| |||||||    
52742786 agaagaagatgaagaaaggtgagaaaaatattaggtgtcagtggtttacagtaaaata 52742843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 3798323 - 3798383
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
3798323 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 3798383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 14244619 - 14244559
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
14244619 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 14244559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 17738725 - 17738665
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
17738725 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 17738665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 24370114 - 24370174
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24370114 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24370174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45678711 - 45678771
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45678711 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45678771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 48225453 - 48225393
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
48225453 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 48225393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 50227973 - 50227913
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
50227973 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 50227913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 53)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 117 - 237
Target Start/End: Original strand, 9311019 - 9311139
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||        ||| ||||||||||||||||||||| ||||    
9311019 taggcttaattgctattttagtcccttatctaattttttggtatcgctttggtcccataactaaaaaaaagtctgttttggtattttaacttttgttccg 9311118  T
217 ttacatgttttagtcctttcc 237  Q
    || | |||||| |||||||||    
9311119 tttcttgttttggtcctttcc 9311139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 108 - 236
Target Start/End: Complemental strand, 9312245 - 9312117
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaact 207  Q
    |||||||  |||| ||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||        ||||||||||||||||||| |    
9312245 aataaaaagtaggtttaattgctattttagtcctttaactaattttttggtatcgctttgatcccataactaaaaaaaagtccgttttggtattttaatt 9312146  T
208 tttgctccgttacatgttttagtcctttc 236  Q
    ||||||| || ||||||||||||||||||    
9312145 tttgctctgtcacatgttttagtcctttc 9312117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 237
Target Start/End: Original strand, 14816570 - 14816687
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||        ||| ||||||||||||||||||||| ||||||    
14816570 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccattactaaaaaaa-gtctgttttggtattttaacttttgttccgtt 14816668  T
219 acatgttttagtcctttcc 237  Q
     | |||||| || ||||||    
14816669 tcttgttttggttctttcc 14816687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 14829170 - 14829053
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||        ||| ||||||||||||||||||||| ||||||    
14829170 ggcttaattgctattttagtcccttaactaattttttggtatcgctttggtcccattactaaaaaaa-gtctgttttggtattttaacttttgttccgtt 14829072  T
219 acatgttttagtcctttcc 237  Q
     | |||||| || ||||||    
14829071 tcttgttttggttctttcc 14829053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 39567061 - 39567120
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||    
39567061 taggcttaattgttattttcgtcccttaactaattttttggtatcgctttggtcccataa 39567120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 39270853 - 39270795
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||    
39270853 aggcttaattgctattttcgtcccttaacttattttttggtatcgttttggtcccataa 39270795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 45378605 - 45378549
Alignment:
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||    
45378605 gcttaattgctattttcgtcccttaaataattttttggtatcgctttggtcccataa 45378549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 44633830 - 44633775
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| || ||||||||||||||||||||||| |||||||||||||    
44633830 cttaattgctattttggttccttaactaattttttggtatcgctttggtcccataa 44633775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 156
Target Start/End: Complemental strand, 14819430 - 14819391
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttg 156  Q
    ||||||||||||||||||||||||||||||||||||||||    
14819430 taggcttaattgctattttagtcccttaactaattttttg 14819391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 39568564 - 39568509
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||| ||||||||||||||||||| |||||| |||||| ||||||    
39568564 cttaattgctatttttgtcccttaactaattttttagtatcgttttggttccataa 39568509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 44632698 - 44632760
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccca 173  Q
    |||| ||||| |||||||||||||| ||| ||||| |||||||||||||||| ||||||||||    
44632698 aaaaaataggtttaattgctattttcgtctcttaattaattttttggtatcgttttggtccca 44632760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 178
Target Start/End: Original strand, 29802150 - 29802219
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
29802150 ataaaatttaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 29802219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 35 - 116
Target Start/End: Complemental strand, 7486408 - 7486326
Alignment:
35 gaatgattatgttgatgaagatta--agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||| ||| |||| ||||||||||  ||||||| |||||||| |||||||||||||||  |||||||| |||||||||||||||    
7486408 gaatcattgtgtttatgaagattaggagaagaagatgaagaa-ggtgagaaaaatattaggtgttggtggtttacaataaaata 7486326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 29 - 116
Target Start/End: Original strand, 41522488 - 41522588
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaaaatg-------------aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaat 115  Q
    |||||||||||||||||||||||||||| |||||||| |||             |||||||||||||||||||||  |||||||| ||||||||||||||    
41522488 ttttaggaatgattatgttgatgaagatgaagaagaagatgggagaagatgataaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaat 41522587  T
116 a 116  Q
    |    
41522588 a 41522588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 4326034 - 4325973
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
4326034 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 4325973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 5822093 - 5822024
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| | |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
5822093 ataaaaaaaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 5822024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 107 - 172
Target Start/End: Original strand, 43633111 - 43633176
Alignment:
107 caataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||| |||||||||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||||    
43633111 caattaaatataggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtccc 43633176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 5876895 - 5876835
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
5876895 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 5876835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 12823259 - 12823319
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||| |||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
12823259 aaataaaggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 12823319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 21524716 - 21524656
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
21524716 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 21524656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45467436 - 45467496
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
45467436 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 45467496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 10134606 - 10134665
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
10134606 taggcttaaatgctctttttgtcccttaagtatttatttggtatcgctttggtcccataa 10134665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 29802631 - 29802576
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
29802631 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 29802576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 31445661 - 31445728
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31445661 aaaaaataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 31445728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 36194996 - 36194937
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| |||| ||||||||||||||||   ||||  ||||||||||||||||||||    
36194996 taggcttaaatgctcttttagtcccttaacttgattttaagtatcggtttggtcccataa 36194937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 45377427 - 45377478
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    |||||||||| |||||| ||||||||| | |||||||||||||| |||||||    
45377427 ggcttaattgttattttcgtcccttaattgattttttggtatcgctttggtc 45377478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 162415 - 162461
Alignment:
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
162415 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 162461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 2222031 - 2221965
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
2222031 aaatataggtttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 2221965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 11760980 - 11760914
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11760980 aaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 11760914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 3318098 - 3318037
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||| | |||||||||| ||| ||||||||| |||||    
3318098 taggcttaattactcttttggtcccttaatttattttttggtttcgttttggtcccttaact 3318037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7116470 - 7116531
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
7116470 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 7116531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 9807340 - 9807279
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
9807340 taggcttaaatgctcttttggtcccttaactatttaattggtatcgttttggtcccttaact 9807279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 11713198 - 11713259
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11713198 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 11713259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 12849962 - 12850023
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
12849962 taggctaaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 12850023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 13463206 - 13463153
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
13463206 ggcttaattgctcttttcgtcccttaagttattatttggtatcgctttggtccc 13463153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 18476140 - 18476071
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||| |||| |||| |||||||||||| ||  || |||||| ||||||||| |||||    
18476140 ataaaatttaggcttaaatgctcttttggtcccttaactatttaatttgtatcgctttggtcccctaact 18476071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 33099030 - 33098969
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
33099030 taggcttaaatgctcttttggtcccttaactatttaattggtatcgatttggtcccttaact 33098969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 41836492 - 41836553
Alignment:
118 aggcttaattgctattttagtcccttaactaattt-tttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||||||||||||||||||||  ||||||||| ||||| ||| |||||    
41836492 aggcttaaatgctcttttagtcccttaactaatttaattggtatcgctttggacccttaact 41836553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 162726 - 162662
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||  ||||||||||| |||||| ||| ||| ||||||||| |||||    
162726 atataggcttaattactctttgggtcccttaacttatttttaggtttcgttttggtcccttaact 162662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 2221593 - 2221653
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
2221593 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 2221653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 7042021 - 7041957
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||||| ||||||  |||| |||||||||||| || | | |||||| |||||||||    
7042021 aataaaatataggctaaattgcatttttggtcccttaactatttatatagtatcgctttggtccc 7041957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 10398757 - 10398697
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
10398757 aggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 10398697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 11901554 - 11901494
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| | | ||||||||| |||||    
11901554 aggcttaattacttttttggtcccttaacttattttttggtttggttttggtcccttaact 11901494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 14054787 - 14054847
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
14054787 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtaccttaact 14054847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 22013461 - 22013521
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
22013461 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 22013521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26060105 - 26060165
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
26060105 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 26060165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 31933645 - 31933581
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||| |||| |||| |||||||||||   |||   ||||||||||||||||||||    
31933645 aaatataggcttaaatgctcttttggtcccttaacttgatttcaagtatcggtttggtcccataa 31933581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 31988513 - 31988573
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
31988513 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 31988573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 41155073 - 41155013
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
41155073 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 41155013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 41387612 - 41387560
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggt 169  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||    
41387612 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggt 41387560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 45123219 - 45123279
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
45123219 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 45123279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 45466360 - 45466300
Alignment:
110 taaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtc 170  Q
    ||||||| |||||||| |||| |||| |||||||||||| ||  ||||||||| |||||||    
45466360 taaaataaaggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtc 45466300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 45467868 - 45467808
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| | | ||||||||| |||||    
45467868 aggcttaattactcttttggtcccttaacttattttttggttttgttttggtcccttaact 45467808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 38)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 117 - 226
Target Start/End: Original strand, 7184879 - 7184989
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact-nnnnnnnggtccgttttggtattttaacttttgctcc 215  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||        ||||||||||||||||||||||||| ||||    
7184879 taggcttaattgctattttagtctcttaactaattttttggtatcggtttgatcccataactaaaaaaaaggtccgttttggtattttaacttttactcc 7184978  T
216 gttacatgttt 226  Q
    ||||| |||||    
7184979 gttacttgttt 7184989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 36889806 - 36889748
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36889806 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 36889748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36888337 - 36888397
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
36888337 aggcttaattgctattttagtcccttagctaattttttggtatcggtttggtcccataact 36888397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 237
Target Start/End: Original strand, 13809426 - 13809542
Alignment:
120 gcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccgtta 219  Q
    |||||||| ||||||||| |||||||||||||||||||||||| |||| ||| |||| |       | |||||||| ||||||||||||||| ||||| |    
13809426 gcttaatttctattttaggcccttaactaattttttggtatcgctttgatcctataattaaaaaaag-tccgttttagtattttaacttttgttccgtca 13809524  T
220 catgttttagtcctttcc 237  Q
    ||||||||||||||||||    
13809525 catgttttagtcctttcc 13809542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 236
Target Start/End: Complemental strand, 13810644 - 13810521
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaactttt 210  Q
    |||| |||||||||||||| ||||||||| |||||||||  ||||||||||| |||||||||||||||        ||||| ||||||||||||||||||    
13810644 aaaagataggcttaattgcaattttagtctcttaactaa--ttttggtatcgctttggtcccataactaaaaaaaagtccgatttggtattttaactttt 13810547  T
211 gctccgttacatgttttagtcctttc 236  Q
    | || ||| | |||||| ||| ||||    
13810546 gttctgtttcttgttttggtcatttc 13810521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 35738361 - 35738453
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttt 209  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||| |||||| ||||| ||       | ||| ||||||||||||||||||    
35738361 taggcttaattactattttcgttccttaactaattttttggtatcgctttggttccatatctaaaatttgatccattttggtattttaacttt 35738453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 7031803 - 7031864
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
7031803 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 7031864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 7032224 - 7032155
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||||||| || |||| ||||||||||| ||||||| || ||| ||||||||| |||||    
7032224 ataacatataggcttaattactcttttggtcccttaacttattttttagtttcgttttggtcccttaact 7032155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 27516157 - 27516218
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
27516157 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 27516218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 7983472 - 7983508
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
7983472 ttttaggaatgattatgttgatgaagatgaagaagaa 7983508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26892463 - 26892523
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
26892463 aggcttaattgctcttttggtcccttaacttattttttggtttcgttttgatcccttaact 26892523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 26897902 - 26897962
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||| ||||||||||| |||||||||| ||| |||| |||| |||||    
26897902 aggcttaattgctcttttggtcccttaacttattttttggtttcgttttgatcccttaact 26897962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 32194892 - 32194828
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
32194892 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 32194828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 34166841 - 34166901
Alignment:
117 taggcttaattgctattttagtcccttaacta-attttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| ||||||||| ||  |||||||||||| |||| |||||||||    
34166841 taggcttaattgctattttcgtcccttaaatattttttttggtatcagttttgtcccataa 34166901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Complemental strand, 15130120 - 15130053
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||||||||||| || ||||  |||||||||| |||||||||| ||| ||||||||| |||||    
15130120 aaaaaataggcttaattactcttttgatcccttaacttattttttggtttcgttttggtcccttaact 15130053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 31557091 - 31557150
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
31557091 ggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 31557150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 34618580 - 34618521
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| |||| ||||||||||||||||| ||  ||||||||| ||||||||| |||||    
34618580 ggcttaaatgctcttttagtcccttaactatttaattggtatcgctttggtcccttaact 34618521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 35251488 - 35251555
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||| |||||||||| || |||| ||||||||||| | |||||||| ||| ||||||||| |||||    
35251488 aaaataaaggcttaattactcttttggtcccttaacttaatttttggtttcgttttggtcccttaact 35251555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 38578242 - 38578187
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
38578242 taggcttaattactcttttggtcccttaacttattttttggtgtcgttttggtccc 38578187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 19297526 - 19297580
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    ||||||||||||| |||| ||||||||| | ||| |||||||||| |||||||||    
19297526 aggcttaattgctcttttcgtcccttaagttattatttggtatcgttttggtccc 19297580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 30785836 - 30785882
Alignment:
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
30785836 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 30785882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 31309692 - 31309646
Alignment:
132 ttttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||    
31309692 ttttagtcccttaacttattttttggtttcgttttggtcccttaact 31309646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 3603504 - 3603557
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||| |||||| |||||||||||| || ||| |||||| |||||||||    
3603504 ggcttaattgttattttcgtcccttaactatttatttagtatcgctttggtccc 3603557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 4602877 - 4602816
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
4602877 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 4602816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 111
Target Start/End: Original strand, 7983526 - 7983567
Alignment:
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaata 111  Q
    |||||||||||||||||||||  |||||||| ||||||||||    
7983526 aagaaaggtgagaaaaatattaggtgttggtggtttacaata 7983567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 11131248 - 11131183
Alignment:
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||| |||| ||| |||| |||||||||||||| || || |||||||||| ||||||||| |||||    
11131248 aataaaggcataaatgctcttttagtcccttaagtatttatttggtatcgctttggtcccttaact 11131183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 171
Target Start/End: Original strand, 15044738 - 15044791
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||    
15044738 aggcttaagtgctattttggtcccttaactatttaattggtatcgctttggtcc 15044791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 18904597 - 18904658
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| ||||||| || ||| ||||||||| |||||    
18904597 taggcttaattactcttttggtcccttaacttatttttttgtttcgttttggtcccttaact 18904658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 27516601 - 27516540
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
27516601 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 27516540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 28190550 - 28190493
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||||||||||||||| |||| ||||||||| | ||| |||||||||  |||||||||    
28190550 tataggcttaattgcttttttcgtcccttaagttattatttggtatcattttggtccc 28190493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 28958179 - 28958114
Alignment:
113 aatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||| || |||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
28958179 aatattggtttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 28958114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 31309827 - 31309766
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
31309827 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 31309766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 36099291 - 36099352
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
36099291 taggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcccttaact 36099352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 3124327 - 3124387
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |  |||||||||||||||||||| | |||| ||  |||||||||||||||    
3124327 aggcttaattacatttttagtcccttaactaattatgtggtttcattttggtcccataact 3124387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 7182758 - 7182698
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||| |||||    
7182758 aggcttaattactcgtttggtcccttaacttattttttggtttcgttttggtcccttaact 7182698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 30786089 - 30786025
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||  | |||| || |||||||| |||||||||| ||| ||||||||| |||||    
30786089 atataggcttaattatttttttggttccttaacttattttttggtgtcgttttggtcccttaact 30786025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 35589229 - 35589165
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||  | | ||||||||| |||||    
35589229 atataggcttaattactcttttggtcccttaacttattttttggctttgttttggtcccttaact 35589165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 45001045 - 45001105
Alignment:
111 aaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    ||||| ||||||||||| ||  ||| ||||||||||| |||||||||| ||| ||||||||    
45001045 aaaatttaggcttaattactcatttggtcccttaacttattttttggtttcgttttggtcc 45001105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 32)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 117 - 237
Target Start/End: Complemental strand, 19718950 - 19718830
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataactnnnnnnnggtccgttttggtattttaacttttgctccg 216  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| |||| ||| ||||||         |||||||||||||||||||||||  ||||    
19718950 taggcttaattgctattttagtcctttaactaattttttggtatcgctttgatcctataactaaaaaaaaatccgttttggtattttaacttttattccg 19718851  T
217 ttacatgttttagtcctttcc 237  Q
    | |||||||||||||||||||    
19718850 tcacatgttttagtcctttcc 19718830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 4959559 - 4959620
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
4959559 taggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 4959620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 11079690 - 11079629
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
11079690 taggcttaaatgctattttggtcccttaactatttaattggtatcgttttggtcccttaact 11079629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 19798788 - 19798719
Alignment:
109 ataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||||||| |||| |||| ||||||||| || || |||||||||  ||||||||| |||||    
19798788 ataaaatataggcttaaatgctcttttggtcccttaagtatttatttggtatcactttggtcccttaact 19798719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 22803650 - 22803589
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
22803650 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 22803589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 37812229 - 37812290
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
37812229 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 37812290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 42026724 - 42026663
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
42026724 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 42026663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 1155963 - 1156023
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
1155963 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 1156023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 7426990 - 7426954
Alignment:
29 ttttaggaatgattatgttgatgaagattaagaagaa 65  Q
    |||||||||||||||||||||||||||| ||||||||    
7426990 ttttaggaatgattatgttgatgaagatgaagaagaa 7426954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 30112769 - 30112709
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||||| |||||||||||||| || ||  ||||||||| ||||||||| |||||    
30112769 aggcttaattgctcttttagtcccttaagtatttaattggtatcgctttggtcccttaact 30112709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 42026278 - 42026342
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
42026278 atataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 42026342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 4349495 - 4349554
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| |||| ||||||||||    
4349495 ggcttaattactcttttggtcccttaacttattttttggtttcgttttgatcccataact 4349554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 4349933 - 4349874
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
4349933 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 4349874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 6172399 - 6172340
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
6172399 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 6172340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 9040743 - 9040802
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
9040743 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 9040802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 9438237 - 9438296
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
9438237 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 9438296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 11079124 - 11079187
Alignment:
115 tataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| |||| ||||||||| ||||||| ||  ||||||||| ||||||||| |||||    
11079124 tataggcttaaatgctcttttagtccattaactatttaattggtatcgctttggtcccttaact 11079187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 24100326 - 24100267
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| |||||||||| || |||||    
24100326 ggcttaattactcttttggtcccttaacttattttttggtttcggtttggttccttaact 24100267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 31369985 - 31369926
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
31369985 ggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 31369926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 42382231 - 42382172
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
42382231 ggcttaattactcttttggtcccttaacttattttttggtttcgatttggtcccttaact 42382172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 116
Target Start/End: Complemental strand, 7426936 - 7426890
Alignment:
70 aagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    |||||||||||||||||||||  ||| |||| |||||||||||||||    
7426936 aagaaaggtgagaaaaatattaggtgatggtagtttacaataaaata 7426890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 8127467 - 8127525
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtccc 172  Q
    |||| ||||||||| || |||| ||||||||||| |||||||||| ||| |||||||||    
8127467 atattggcttaattactcttttggtcccttaacttattttttggtttcgttttggtccc 8127525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 16670089 - 16670027
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
16670089 ataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 16670027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 43476499 - 43476437
Alignment:
116 ataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
43476499 ataggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 43476437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 435552 - 435613
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
435552 taggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 435613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 6157557 - 6157496
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
6157557 taggcttaaatgctcttttggtcccttaactatttaattggtatcgatttggtcccttaact 6157496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 16791969 - 16792030
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
16791969 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 16792030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 21289590 - 21289529
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
21289590 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 21289529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 171
Target Start/End: Complemental strand, 25333247 - 25333194
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcc 171  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||    
25333247 aggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcc 25333194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 37812607 - 37812550
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
37812607 cttaattacttttttggtcccttaacttattttttggtttcgttttggtcccttaact 37812550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 17339794 - 17339854
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
17339794 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 17339854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 24100759 - 24100699
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
24100759 aggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 24100699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 19304 - 19244
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||||| ||||||||||||||||| |||||||||||||||||||||    
19304 aggcttaattgttactttagttccttaactaattttttgatatcggtttggtcccataact 19244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 18070 - 18127
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| ||||||||||||||||||||||||||  |||||||||||||| |||||||    
18070 cttaattactattttagtcccttaactaatttttgagtatcggtttggtctcataact 18127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 129488 - 129420
Alignment:
108 aataaaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||| ||||||||||| |||||| ||||||||||| |||||||||||||  |||||||||||||    
129488 aataaaatacaggcttaattgttattttcgtcccttaacttattttttggtatcactttggtcccataa 129420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 123422 - 123481
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||| ||||||| | |||||||||||||    
123422 taggcttaattgctattttcgtcccttaactaatttcttggtattgctttggtcccataa 123481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 134298 - 134357
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||||||||||||||| |||||||||||||||| ||||||| | |||||||||||||    
134298 taggcttaattgctattttcgtcccttaactaatttcttggtattgctttggtcccataa 134357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0025
Description:

Target: scaffold0025; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 59 - 116
Target Start/End: Original strand, 56508 - 56565
Alignment:
59 agaagaaaatgaagaaaggtgagaaaaatatttagtgttggttgtttacaataaaata 116  Q
    ||||||| ||||||||||||||||||||||||  |||||||| |||||||||||||||    
56508 agaagaagatgaagaaaggtgagaaaaatattaggtgttggtggtttacaataaaata 56565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0295 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0295
Description:

Target: scaffold0295; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 8275 - 8215
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
8275 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 8215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 83445 - 83385
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| ||||||||| |||||||||||| ||  ||||||||| ||||||||| |||||    
83445 aggcttaaatgctattttggtcccttaactatttaattggtatcgctttggtcccttaact 83385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 1470 - 1534
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
1470 atataggcttaaatgctcttttggtcccttaactatttaattggtatcgctttggtcccttaact 1534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0352
Description:

Target: scaffold0352; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 11489 - 11423
Alignment:
112 aaatataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||||||| || |||| ||||||||||| | |||||||| ||| |||||| || |||||    
11489 aaatataggcttaattactcttttggtcccttaacttaatttttggtttcgttttggttccttaact 11423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0220 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0220
Description:

Target: scaffold0220; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 25963 - 26020
Alignment:
119 ggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataa 176  Q
    ||||||| |||| |||| ||||||||| || || |||||||||| |||||||||||||    
25963 ggcttaaatgctcttttggtcccttaagtatttatttggtatcgctttggtcccataa 26020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135 (Bit Score: 30; Significance: 0.0000001; HSPs: 6)
Name: scaffold0135
Description:

Target: scaffold0135; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 5917 - 5856
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
5917 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 5856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 10132 - 10071
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
10132 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 10071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 14347 - 14286
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
14347 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 14286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 18562 - 18501
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
18562 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 18501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 22777 - 22716
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
22777 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 22716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0135; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 26992 - 26931
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||| ||||| |||||||||| ||| ||||||||| |||||    
26992 taggcttaattactcttttggtcccctaacttattttttggtttcgctttggtcccttaact 26931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 57020 - 57081
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| | |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
57020 taggcttaattgttcttttggtcccttaactatttaattggtatcgctttggtcccttaact 57081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 57617 - 57557
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| | |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
57617 aggcttaattgttcttttggtcccttaactatttaattggtatcgctttggtcccttaact 57557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 100040 - 99979
Alignment:
117 taggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
100040 taggcttaattactcttttggtcccttaacttattttttggtttcgttttggtaccttaact 99979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0017
Description:

Target: scaffold0017; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 172967 - 172910
Alignment:
121 cttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    ||||||| || |||| ||||||||||| |||||||||| ||| ||||||||| |||||    
172967 cttaattactcttttggtcccttaacttattttttggtttcgttttggtcccttaact 172910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 230871 - 230931
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||| |||| |||| |||||||||||| ||  ||||||||| ||||||||| |||||    
230871 aggcttaaatgcttttttggtcccttaactatttaattggtatcgctttggtcccttaact 230931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 144717 - 144777
Alignment:
118 aggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||| || |||| ||||||||||| |||||||||| ||| |||||| || |||||    
144717 aggcttaattactcttttggtcccttaacttattttttggtttcgttttggttccttaact 144777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 242224 - 242160
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcggtttggtcccataact 178  Q
    |||||||||||| |||| |||| |||||||||||| ||  ||||||||  ||||||||| |||||    
242224 atataggcttaaatgctcttttggtcccttaactatttaattggtatcactttggtcccttaact 242160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 162
Target Start/End: Complemental strand, 429211 - 429163
Alignment:
114 atataggcttaattgctattttagtcccttaactaattttttggtatcg 162  Q
    ||||||||||||||||| |||| ||||||||| | ||| ||||||||||    
429211 atataggcttaattgcttttttggtcccttaagttattatttggtatcg 429163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149718 times since January 2019
Visitors: 1518