View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_19 (Length: 260)

Name: NF1565_low_19
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_19
[»] chr2 (1 HSPs)
chr2 (8-244)||(36331784-36332020)
[»] chr4 (1 HSPs)
chr4 (103-187)||(19275472-19275556)
[»] chr8 (1 HSPs)
chr8 (96-142)||(40631994-40632040)

Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 244
Target Start/End: Complemental strand, 36332020 - 36331784
8 acattatactaaattaaatactatacaaaccaaaatgaataaaacagtactgtctcatacattaagcttgatgaaggattattattattaatcctatgat 107  Q
36332020 acattatactaaattaaatactatacaaaccaaaatgaataaaacagtactgtctcatacattaagcttgatgaaggattattattattaatcctatgat 36331921  T
108 gaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcataaatattctttagaccattc 207  Q
36331920 gaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcataaatattctttagaccattc 36331821  T
208 tcatatcctataaagcaaaattcaattcacataaaca 244  Q
36331820 tcatatcctataaagcaaaattcaattcacataaaca 36331784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 187
Target Start/End: Complemental strand, 19275556 - 19275472
103 atgatgaattccataagggacatgatgagttgaatgtcctgtctcagaaaaatcaagttctcctattctttggctcgccatgcat 187  Q
    |||| ||| ||||||||||||||| ||| ||||| |||| | |||||| ||| ||| |||||| ||||||||||| |||||||||    
19275556 atgaagaactccataagggacatgttgacttgaaggtccagactcagacaaaccaatttctccaattctttggctagccatgcat 19275472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 142
Target Start/End: Original strand, 40631994 - 40632040
96 taatcctatgatgaattccataagggacatgatgagttgaatgtcct 142  Q
    |||||||||||||||| |||||||| ||||||| | |||||||||||    
40631994 taatcctatgatgaataccataaggaacatgattacttgaatgtcct 40632040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149080 times since January 2019
Visitors: 1515