View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_2 (Length: 584)

Name: NF1565_low_2
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_2
NF1565_low_2
[»] chr5 (15 HSPs)
chr5 (54-567)||(15082940-15083453)
chr5 (54-569)||(15429198-15429714)
chr5 (148-570)||(15331261-15331683)
chr5 (112-566)||(15347050-15347504)
chr5 (130-570)||(15335698-15336135)
chr5 (127-570)||(16403324-16403767)
chr5 (132-562)||(16396737-16397167)
chr5 (135-570)||(15357342-15357777)
chr5 (205-570)||(15453039-15453404)
chr5 (112-569)||(16414042-16414499)
chr5 (198-554)||(17927726-17928082)
chr5 (54-255)||(15421638-15421838)
chr5 (516-563)||(30521164-30521211)
chr5 (516-563)||(30561504-30561551)
chr5 (505-563)||(17983407-17983465)
[»] chr3 (1 HSPs)
chr3 (112-570)||(8187150-8187608)


Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 54 - 567
Target Start/End: Original strand, 15082940 - 15083453
Alignment:
54 gagatggcgaattctttctaacgtatttggcatgtcatcgttttttgtaatgcagcacacctcttctgaaatcgactgagcaagatcatgaacaagatcg 153  Q
    ||||||||| |||||||| || ||| | ||||||||||| ||| |||||||||| |||||||| |||||||| || ||||||||||| ||||||||||||    
15082940 gagatggcggattctttcaaatgtactaggcatgtcatcatttcttgtaatgcaacacacctcatctgaaattgattgagcaagatcgtgaacaagatcg 15083039  T
154 tgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattccacatctcattaccgatatctt 253  Q
    ||||||||||||||| ||||||  |||||||||||| |||||| |||||||||||||||||| ||||||| |||||||||||  |||||  |||||||||    
15083040 tgcatcttgaaacttgtaattttgccaaatacatctgtctcaatatcttgaaaaaatgatctacaatataattcattccacacatcattgtcgatatctt 15083139  T
254 ccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattatttcatctttgggaaatagtgcaca 353  Q
    |  ||||||| | ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||  |||||||| ||||||||||||||||||||||    
15083140 cttcgtccaatattttattggacgaaataaagccattagccatccaaagctcaattagaaactgcttccttattattgcatctttgggaaatagtgcaca 15083239  T
354 gaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatcttcatcttgtaaactccataatttgctt 453  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||    
15083240 gaaggcaaaacattgtctcagtttaagcggcaaattcaagtaacttaatctcaacgcaggcatggcataatcttcatcttgtaaactccatagtttgctt 15083339  T
454 tccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggcactcccccacacttctttagtatct 553  Q
    ||||| ||||||| |||||| ||||| | | |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||    
15083340 tccttcacatagtgccactctttttcctctgttttaaagcgcaagagacttcctagtgctattgcagcaagaggcgctcccccacacttctttaatatct 15083439  T
554 cctttcctatgacc 567  Q
    ||||| ||||||||    
15083440 cctttactatgacc 15083453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 54 - 569
Target Start/End: Complemental strand, 15429714 - 15429198
Alignment:
54 gagatggcgaattctttctaacgtatttggcatgtcatcgttttttgtaatgcagcacacctcttctgaaatcgactgagcaagatcatgaacaagatcg 153  Q
    ||||||||| ||||||||||| ||| | |||||||||||| ||||||||| | | ||||||||||||||||| |||||||| ||||||||||||||||||    
15429714 gagatggcggattctttctaatgtactaggcatgtcatcgatttttgtaaagaaacacacctcttctgaaattgactgagcgagatcatgaacaagatcg 15429615  T
154 tgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattccacatctcattaccgatatctt 253  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||  |||||  |||||||||    
15429614 tgcatcttgaaacttataatttcgccaaatacatctctctcaaaatcttgaaaaaaggatctccaatatatttcattccacacatcattcgcgatatctt 15429515  T
254 ccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattatttcatctttgggaaatagtgcaca 353  Q
    || ||||||||| || |||||| ||||||||| ||||||||||||||||||  ||||| ||||| ||  ||||| |||||||||||||||||| ||||||    
15429514 cctcgtccaacatttcattggaagaaataaagtcattagccatccaaagctgaattagtaactgcttacttattctttcatctttgggaaataatgcaca 15429415  T
354 gaaggcaaaacattgtctcagtttaatcggcaaattcaagt-aacttaatctcaacgcaggcatgacattatcttcatcttgtaaactccataatttgct 452  Q
    ||||||||||||||||||||||||||  ||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||| |||||| ||||||    
15429414 gaaggcaaaacattgtctcagtttaactggcaaattcaagtaaacttaatctcaatgcaggcatgacattttcttcatcttgtaaattccatattttgct 15429315  T
453 ttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggcactcccccacacttctttagtatc 552  Q
    |||||||| ||||  |||||| ||||| | ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||    
15429314 ttccttgatatagcgccactccttttcctctcttttaaagcgcaagagacttcctagtgcttttgctgcaagaggtactcccccacatttccttagtatc 15429215  T
553 tcctttcctatgaccac 569  Q
    |||||||||||||||||    
15429214 tcctttcctatgaccac 15429198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 148 - 570
Target Start/End: Original strand, 15331261 - 15331683
Alignment:
148 agatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattccacatctcattaccga 247  Q
    ||||| ||||||||||||||| ||||||  ||||||| |||| |||||| |||||| |||||||||||| | |||| ||||||||||| | |||| || |    
15331261 agatcatgcatcttgaaacttgtaattttgccaaatatatctgtctcaatatcttggaaaaatgatctcaagtataattcattccacaccccattgccaa 15331360  T
248 tatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattatttcatctttgggaaatag 347  Q
    |||||||| ||||||||| || ||| || ||||  ||||||||||||||||||||||| ||||| ||||  ||  ||||| |||||||||||  ||||||    
15331361 tatcttcctcgtccaacatttcattagatgaaaccaagccattagccatccaaagctcaattagaaacttcttacttattctttcatctttgataaatag 15331460  T
348 tgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatcttcatcttgtaaactccataat 447  Q
     |||||||||||||| |||||||||| ||| |  |||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||    
15331461 agcacagaaggcaaagcattgtctcaattttactggcaaattcaagtaacttaatctcaaggtaggcatgacataatcttcatcttgtaaactccataat 15331560  T
448 ttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggcactcccccacacttcttta 547  Q
    ||||||||||||||||||| |||||||||| | | ||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
15331561 ttgctttccttgacatagtgccactcatttacctctcttttaaaacgcaagagacttcctagtgctattgctgcaagaggtactccgccacacttcttta 15331660  T
548 gtatctcctttcctatgaccaca 570  Q
    ||||||| || ||||| ||||||    
15331661 gtatctctttccctattaccaca 15331683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 112 - 566
Target Start/End: Original strand, 15347050 - 15347504
Alignment:
112 acctcttctgaaatcgactgagcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatg 211  Q
    ||||||||||  || || ||||||||||||||||||||||| |||||| |||||  || ||||| ||||||  ||||| ||| |  ||||||||||||||    
15347050 acctcttctgtgatagattgagcaagatcatgaacaagatcatgcatcgtgaaatatacaatttgtccaaaatcatctgtctgagtatcttgaaaaaatg 15347149  T
212 atctccaatatagttcattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattag 311  Q
    |||| ||||||| |||||||||    |||||||| ||||||||  | ||||||| |  |||||| | |||||| |||||||||||||||||||| ||||     
15347150 atctacaatataattcattccatgcttcattaccaatatcttctgcttccaacattccattggatggaataaatccattagccatccaaagctcaattac 15347249  T
312 gaactgtttggttattatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgca 411  Q
     ||||||||| |||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||    
15347250 aaactgtttgcttataatttcatccttgggaaatagtgcacaaaaggcaaaacattgtctcaattttaccggcaaattcaagtaacttaatctcaacgca 15347349  T
412 ggcatgacattatcttcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtg 511  Q
    |||||||||  ||  ||| |||||||| ||||||  || |||||||||||||||  ||| || ||||||| || |||||| ||||| | |||||| ||||    
15347350 ggcatgacagaattctcaccttgtaaattccatagcttactttccttgacatagcgccattccttttcttctcgtttaaaccgcaataaacttcccagtg 15347449  T
512 ctattgctgcaagaggcactcccccacacttctttagtatctcctttcctatgac 566  Q
    || ||||||| ||||| ||||||| |||||| |||| |||||| || ||||||||    
15347450 cttttgctgcgagagggactcccctacacttttttactatctctttccctatgac 15347504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 163; E-Value: 9e-87
Query Start/End: Original strand, 130 - 570
Target Start/End: Original strand, 15335698 - 15336135
Alignment:
130 tgagcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcat 229  Q
    ||||||||||||||||||||||| ||||| ||||||||   | |||  ||||||  |||| |||||| |||||||||||||||||||||||||| |||||    
15335698 tgagcaagatcatgaacaagatcatgcattttgaaact---agttttcccaaattgatctatctcaatatcttgaaaaaatgatctccaatataattcat 15335794  T
230 tccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattat 329  Q
    |||||| |||||| || |||||  |  | ||||||  || ||| || ||||||||||||||||||||||| || || ||||| || |||||  ||||||     
15335795 tccacacctcattgccaatatcaccatcttccaacttttcatttgaagaaataaagccattagccatccagagttctattagaaagtgttttcttattag 15335894  T
330 ttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatcttca 429  Q
    || |||||||||||| |||||||| ||||||||||| ||||||| ||| |  || |||||||| ||||||| |||||| |||||||||||   ||  |||    
15335895 tttatctttgggaaagagtgcacacaaggcaaaacactgtctcaattttactggtaaattcaaataacttagtctcaaggcaggcatgactgaattatca 15335994  T
430 tcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggca 529  Q
     |||||||||||||||  ||||||||||||||||||  |||||||||||| | |||||| || | |||||||||||||||||||||||| ||||||||||    
15335995 ccttgtaaactccatagcttgctttccttgacatagagccactcattttcgtctcttttgaaacacaagagacttcctagtgctattgccgcaagaggca 15336094  T
530 ctcccccacacttctttagtatctcctttcctatgaccaca 570  Q
    ||||| ||||||| || | |||||| || ||||| ||||||    
15336095 ctcccacacactttttaactatctcgttccctataaccaca 15336135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 127 - 570
Target Start/End: Original strand, 16403324 - 16403767
Alignment:
127 gactgagcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagtt 226  Q
    |||| |||||| |||||||||||||| |||||||| ||   | ||||||  |||||| ||||| |||||  |||||| ||||||||||||||||||| ||    
16403324 gactcagcaagttcatgaacaagatcatgcatcttaaatgatgtaatttgaccaaattcatctgtctcagtatcttggaaaaatgatctccaatataatt 16403423  T
227 cattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttat 326  Q
    ||||||||| ||||||||| | | ||||  | ||||||| || |||||| ||||| ||||||||||| ||||||||||| || | ||| || ||| | ||    
16403424 cattccacacctcattaccaacaccttctgcatccaacatttgattggatgaaatgaagccattagcaatccaaagctcaatcatgaagtgcttgctcat 16403523  T
327 tatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatct 426  Q
     ||||||||||||||||||| |||||| |||| |||||| ||||||| ||| |  |||||||| | |||||||| | | || |||| | |||| | ||||    
16403524 aatttcatctttgggaaataatgcacaaaaggaaaaacactgtctcaattttactggcaaattgaggtaacttagttttaaggcagacttgacgtaatct 16403623  T
427 tcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagag 526  Q
    ||| ||| |||||||||||  || |||||||| ||||||  |||||| ||||||| ||||||||| ||||| |||||||||||||||||||| |||||||    
16403624 tcaccttctaaactccatagcttactttccttcacatagagccactctttttcttctcttttaaaccgcaaaagacttcctagtgctattgccgcaagag 16403723  T
527 gcactcccccacacttctttagtatctcctttcctatgaccaca 570  Q
    | |||| | ||||||| |||||||||||||||||||||||||||    
16403724 ggactcacacacacttttttagtatctcctttcctatgaccaca 16403767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 132 - 562
Target Start/End: Original strand, 16396737 - 16397167
Alignment:
132 agcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattc 231  Q
    ||||||||||||||||||||| |||||||||||  || ||||||  |||||| |  |  ||||   || ||  |||||||| |||||||||| |||||||    
16396737 agcaagatcatgaacaagatcatgcatcttgaatattgtaatttggccaaatcccacattctctgtattttcgaaaaatgacctccaatataattcattc 16396836  T
232 cacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattattt 331  Q
    |||| ||| ||||| || || ||  | ||||||| || |||||| ||||| ||||| |||||  ||||||| || ||||  | ||| ||| |||| ||||    
16396837 cacacctcgttaccaatgtcatctgcttccaacatttgattggaagaaatgaagccgttagctgtccaaagatcaattaaaagctgcttgcttataattt 16396936  T
332 catctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatcttcatc 431  Q
    ||||||||||||||| ||||||||||| ||| ||||| || | ||| |  ||||||| |||||||||||||||||| ||||||||||||| | ||||| |    
16396937 catctttgggaaataatgcacagaaggaaaagcattgccttaattttactggcaaatgcaagtaacttaatctcaaggcaggcatgacataagcttcacc 16397036  T
432 ttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggcact 531  Q
    ||||||| ||||||  |||||||||||||||||   ||| || ||||||| ||||||||| ||||||||||||||||||||||||||||||||||| | |    
16397037 ttgtaaattccatagcttgctttccttgacatatagccattccttttcttctcttttaaaccgcaagagacttcctagtgctattgctgcaagagggaat 16397136  T
532 cccccacacttctttagtatctcctttccta 562  Q
    |||||||||||||||| ||||||||| ||||    
16397137 cccccacacttctttattatctccttcccta 16397167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 135 - 570
Target Start/End: Original strand, 15357342 - 15357777
Alignment:
135 aagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattccac 234  Q
    |||||||||||||||||| ||||||||||||  || ||||| ||||||| ||| | |||    |||||| ||||||||||| ||||||| ||||||||||    
15357342 aagatcatgaacaagatcatgcatcttgaaagatacaatttttccaaattcatttgtcttggtatcttggaaaaatgatctacaatataattcattccac 15357441  T
235 atctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattaggaactgtttggttattatttcat 334  Q
    | |||||| ||||||||||   | ||||  | || |||||| |||||||| |||||||||||||||||||| || |  ||||| ||  |||| |||| ||    
15357442 acctcattgccgatatcttgtgcttccagtatttcattggatgaaataaatccattagccatccaaagctcaatcaaaaactgcttacttataatttgat 15357541  T
335 ctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgcaggcatgacattatcttcatcttg 434  Q
    | |||| ||| |||||||| |||||||| || || |||| ||| | ||||||||||||||||||||| ||||| | || ||||||   ||  ||| ||||    
15357542 ccttggaaaaaagtgcacaaaaggcaaagcactgcctcaattttaccggcaaattcaagtaacttaacctcaaggaagacatgactgaattctcaccttg 15357641  T
435 taaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtgctattgctgcaagaggcactccc 534  Q
    |||||||||||  ||||||||||||||||||  ||| || ||||||| || |||||| || |||| ||||||||||||| |||| |||||||| ||||||    
15357642 taaactccatagattgctttccttgacatagcgccattccttttcttctcgtttaaaacgtaagaaacttcctagtgcttttgccgcaagaggaactccc 15357741  T
535 ccacacttctttagtatctcctttcctatgaccaca 570  Q
    |||||||| |||| ||||||||| ||||||||||||    
15357742 ccacacttttttactatctccttccctatgaccaca 15357777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 205 - 570
Target Start/End: Complemental strand, 15453404 - 15453039
Alignment:
205 aaaaatgatctccaatatagttcattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagct 304  Q
    |||| |||||||||||||| |||||| |||| ||||| ||| | ||||||  | ||||||| || ||| || |||||||| ||||||   ||||||||||    
15453404 aaaagtgatctccaatataattcattacacacctcatgaccaacatcttctgcttccaacatttgattagaagaaataaaaccattacaaatccaaagct 15453305  T
305 cgattaggaactgtttggttattatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatct 404  Q
    | ||||  | ||  ||| ||||  ||||| |||||||||||| ||||||||||| |||||||||||||| ||| || |||||||| ||||| ||||||||    
15453304 caattatcatcttcttgcttatagtttcacctttgggaaataatgcacagaaggaaaaacattgtctcaattttattggcaaattgaagtagcttaatct 15453205  T
405 caacgcaggcatgacattatcttcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagactt 504  Q
    ||| ||||||||||||  || |||  ||||||||||||| | |||||||| ||||||||||  |||||| ||||||| ||||||||| ||||||||||||    
15453204 caaggcaggcatgacagaattttcgccttgtaaactccaaagtttgcttttcttgacatagagccactctttttcttctcttttaaaacgcaagagactt 15453105  T
505 cctagtgctattgctgcaagaggcactcccccacacttctttagtatctcctttcctatgaccaca 570  Q
    |||||||| |||||||| | ||| ||||| |||||||| |||| ||||||||| ||||||||||||    
15453104 cctagtgcaattgctgccaaaggaactcctccacacttatttactatctccttgcctatgaccaca 15453039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 112 - 569
Target Start/End: Original strand, 16414042 - 16414499
Alignment:
112 acctcttctgaaatcgactgagcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatg 211  Q
    |||||||||| ||| || |||||||||||||| ||||| |||||||| |||||  ||  ||||| ||||||| ||||   ||||| ||||||||||||||    
16414042 acctcttctgtaatggattgagcaagatcatgtacaaggtcgtgcattttgaatttttgaatttttccaaatccatcatgctcaatatcttgaaaaaatg 16414141  T
212 atctccaatatagttcattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattag 311  Q
    ||||||||||||  |||||||||| |||||| || ||||||||    |  ||||    |||||| |||| ||| ||||| ||||||||||| || || |     
16414142 atctccaatataactcattccacacctcattgccaatatcttctgtttgtaacatagcattggatgaaagaaaaccatttgccatccaaaggtcaatcaa 16414241  T
312 gaactgtttggttattatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgca 411  Q
     ||||  ||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||  || ||||||||||||||||| || || |||    
16414242 aaacttcttgtttattatttcatctttgggaaatagtgcacagaaggaaaaacattgtctcaatttaactggtaaattcaagtaacttaaccttaaggca 16414341  T
412 ggcatgacattatcttcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtg 511  Q
    ||||||||    |  ||| ||||||||  |||||  |||||||||||||||| |  ||||||  |||| | |||||| || |||||||||||||||| ||    
16414342 ggcatgacgcagttctcaccttgtaaatcccatagcttgctttccttgacattgagccactctatttcctctcttttgaaacgcaagagacttcctaatg 16414441  T
512 ctattgctgcaagaggcactcccccacacttctttagtatctcctttcctatgaccac 569  Q
    | ||||| |||||||| ||||||| ||| ||||||| |||||| || |||||||||||    
16414442 ccattgcggcaagaggtactcccctacatttctttactatctctttccctatgaccac 16414499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 198 - 554
Target Start/End: Original strand, 17927726 - 17928082
Alignment:
198 atcttgaaaaaatgatctccaatatagttcattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatc 297  Q
    ||||||||||||||| |||||||||| ||||||||||| ||||| ||| ||||||||| | |||||   || |||||||||||| || ||||| |||| |    
17927726 atcttgaaaaaatgaactccaatataattcattccacacctcatcaccaatatcttccgcttccaaactttcattggacgaaatgaatccattggccacc 17927825  T
298 caaagctcgattaggaactgtttggttattatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaac 397  Q
    ||||| || ||||| | ||| ||  |||||| ||||||||| |||||||  ||| |||||||||| ||||||||||  |||| |||||| | ||||||||    
17927826 caaagttcaattagaagctgcttacttattaattcatcttttggaaatatagcagagaaggcaaagcattgtctcaacttaaccggcaagtacaagtaac 17927925  T
398 ttaatctcaacgcaggcatgacattatcttcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaa 497  Q
    |||||||||| ||  ||||||||   |  ||| ||||||| ||||| || ||||| |||||||||||| |||| || ||||||| |||||||||||||||    
17927926 ttaatctcaaggcctgcatgacagagttctcaccttgtaagctccacaacttgctgtccttgacatagatccattctttttcttctcttttaaagcgcaa 17928025  T
498 gagacttcctagtgctattgctgcaagaggcactcccccacacttctttagtatctc 554  Q
     |||||||||| || ||||||||||||||||||||||| |||||||||||| |||||    
17928026 cagacttcctaatgttattgctgcaagaggcactcccctacacttctttaggatctc 17928082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 54 - 255
Target Start/End: Complemental strand, 15421838 - 15421638
Alignment:
54 gagatggcgaattctttctaacgtatttggcatgtcatcgttttttgtaatgcagcacacctcttctgaaatcgactgagcaagatcatgaacaagatcg 153  Q
    ||||||||| ||||||||||| ||| | ||| |||||| | ||||  ||||||| ||||||||||||||||| ||| |||| ||||||||||||||||||    
15421838 gagatggcgtattctttctaatgtactaggcctgtcattgattttcataatgcaacacacctcttctgaaattgaccgagcgagatcatgaacaagatcg 15421739  T
154 tgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatgatctccaatatagttcattccacatctcattaccgatatctt 253  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||    
15421738 tgcatcttgaaacttataatttcaccaaatacatctctctcaaaatcttgaaaaaatgatctccaatacagttcattccacacctcatta-cgatatctt 15421640  T
254 cc 255  Q
    ||    
15421639 cc 15421638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 516 - 563
Target Start/End: Complemental strand, 30521211 - 30521164
Alignment:
516 tgctgcaagaggcactcccccacacttctttagtatctcctttcctat 563  Q
    |||||||||||||| ||||||||||||||||| |||||| ||||||||    
30521211 tgctgcaagaggcaatcccccacacttctttactatctcttttcctat 30521164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 516 - 563
Target Start/End: Complemental strand, 30561551 - 30561504
Alignment:
516 tgctgcaagaggcactcccccacacttctttagtatctcctttcctat 563  Q
    |||||||||||||| ||||||||||||||||| |||||| ||||||||    
30561551 tgctgcaagaggcaatcccccacacttctttactatctcttttcctat 30561504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 505 - 563
Target Start/End: Original strand, 17983407 - 17983465
Alignment:
505 cctagtgctattgctgcaagaggcactcccccacacttctttagtatctcctttcctat 563  Q
    |||| |||| ||||||||||||||| ||| |||||||| |||| ||||||||| |||||    
17983407 cctaatgcttttgctgcaagaggcaatcctccacacttttttactatctccttgcctat 17983465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 112 - 570
Target Start/End: Original strand, 8187150 - 8187608
Alignment:
112 acctcttctgaaatcgactgagcaagatcatgaacaagatcgtgcatcttgaaacttataatttctccaaatacatctctctcaaaatcttgaaaaaatg 211  Q
    ||||||||||| || || |||||||||||||| |||||||| ||||||||||||  |||||||| ||||||| ||||| ||  || |||||| |||||||    
8187150 acctcttctgatatagattgagcaagatcatgtacaagatcatgcatcttgaaatatataatttttccaaattcatctgtcataatatcttggaaaaatg 8187249  T
212 atctccaatatagttcattccacatctcattaccgatatcttccccgtccaacaatttattggacgaaataaagccattagccatccaaagctcgattag 311  Q
    |||||||||||| ||||||||| | |||||| || ||||| ||  | || |  | || |||||| |||||||| |||||||||||||| || || |||||    
8187250 atctccaatataattcattccatacctcattgccaatatcctcagcttctagaatttcattggatgaaataaaaccattagccatccatagatcaattag 8187349  T
312 gaactgtttggttattatttcatctttgggaaatagtgcacagaaggcaaaacattgtctcagtttaatcggcaaattcaagtaacttaatctcaacgca 411  Q
    ||| || ||  |||||| ||||||||| ||||| |||||||| ||||||||||||||||||| ||| || |||||||||||||||||||||||||| |||    
8187350 gaattgcttttttattaattcatcttttggaaaaagtgcacaaaaggcaaaacattgtctcaattttattggcaaattcaagtaacttaatctcaaggca 8187449  T
412 ggcatgacattatcttcatcttgtaaactccataatttgctttccttgacatagttccactcattttcttgtcttttaaagcgcaagagacttcctagtg 511  Q
    ||||||||  |||  ||| |||||||||||||||  || ||||||  |||||||  |||||| ||||| | ||||||||| |||||||||||||||||||    
8187450 ggcatgactgtattctcaccttgtaaactccatagattactttccaagacatagagccactccttttcctctcttttaaaacgcaagagacttcctagtg 8187549  T
512 ctattgctgcaagaggcactcccccacacttctttagtatctcctttcctatgaccaca 570  Q
    |||||||||||||||| || ||||||||||| |||  ||||||||| ||||||||||||    
8187550 ctattgctgcaagaggtacacccccacacttttttgctatctccttccctatgaccaca 8187608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 148989 times since January 2019
Visitors: 1515