View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_20 (Length: 259)

Name: NF1565_low_20
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_20
NF1565_low_20
[»] chr6 (2 HSPs)
chr6 (18-246)||(1180448-1180676)
chr6 (66-244)||(1185861-1186039)
[»] chr4 (1 HSPs)
chr4 (123-205)||(10202788-10202870)


Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 1180448 - 1180676
Alignment:
18 aatacagtattcccaacagatactggaaggtcaggagcaataccatgtcttgccaatcagtgtaattgaagccaaatcacttacaaaattggtgttgcag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
1180448 aatacagtattcccaacagatactggaaggtcaggagcaataccatgtcttgccaatcagtgtaattgaagccaaatcacttacaaagttggtgttgcag 1180547  T
118 gggaatatcaagattgatccagtattcatgaattattcgatcaagtttttctctttgagggaattgtcactaacgcgtgtactttttggagatgaacatg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1180548 gggaatatcaagattgatccagtattcatgaattattcgatcaagtttttctctttgagggaattgtcactaacgcgtgtactttttggagatgaacatg 1180647  T
218 caattagccaactcatctctttttgtcct 246  Q
    |||||| ||||||||||||||||||||||    
1180648 caattaaccaactcatctctttttgtcct 1180676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 66 - 244
Target Start/End: Original strand, 1185861 - 1186039
Alignment:
66 cttgccaatcagtgtaattgaagccaaatcacttacaaaattggtgttgcaggggaatatcaagattgatccagtattcatgaattattcgatcaagttt 165  Q
    |||||||||  |||| ||||||||||||||||||||||| ||||||||| |||||  ||| |||||||||||| |||||| |||| |||| || ||||||    
1185861 cttgccaatgtgtgtcattgaagccaaatcacttacaaagttggtgttggaggggtttataaagattgatccaatattcacgaatcattcaataaagttt 1185960  T
166 ttctctttgagggaattgtcactaacgcgtgtactttttggagatgaacatgcaattagccaactcatctctttttgtc 244  Q
    ||||| ||||||||||||||||||| || ||||||||| | ||||||||||||||| | ||| ||||||||||||||||    
1185961 ttctcattgagggaattgtcactaaggcatgtacttttggtagatgaacatgcaatcaaccacctcatctctttttgtc 1186039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 10202788 - 10202870
Alignment:
123 tatcaagattgatccagtattcatgaattattcgatcaagtttttctctttgagggaattgtcactaacgcgtgtactttttg 205  Q
    |||||||||||||||| || ||||||||||||| |||||||||||||| ||||||| ||||||||||| ||| ||||||||||    
10202788 tatcaagattgatccaataatcatgaattattcaatcaagtttttctcattgagggtattgtcactaaggcgagtactttttg 10202870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142248 times since January 2019
Visitors: 1479