View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_21 (Length: 256)

Name: NF1565_low_21
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_21
NF1565_low_21
[»] chr8 (1 HSPs)
chr8 (1-239)||(43746155-43746402)
[»] chr2 (1 HSPs)
chr2 (64-97)||(39118780-39118813)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43746402 - 43746155
Alignment:
1 atcctttctgttacatttatttttcacccctggctacaagaaacaacc-------------ttattgtaactataagtaataaccacatttcttttttaa 87  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||              |||||||||||||||||||||||||||||||||||||||    
43746402 atcctttctgttacatttatttttcaccccttgctacaagaaacaacactgtcatcatcatttattgtaactataagtaataaccacatttcttttttaa 43746303  T
88 tctttattttatgtatgtattaggttttcatgtataaatctcatgattctgaattagacgatggttaacaaggttgtaagtttttcccttcagtgtttcg 187  Q
    ||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43746302 tctttattttatgtat----taggttttcatgtataaatctcatgattctgaattagacgatggttaacaaggttgtaagtttttcccttcagtgtttcg 43746207  T
188 gtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
43746206 gtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc 43746155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 64 - 97
Target Start/End: Original strand, 39118780 - 39118813
Alignment:
64 gtaataaccacatttcttttttaatctttatttt 97  Q
    |||| |||||||||||||||||||||||||||||    
39118780 gtaagaaccacatttcttttttaatctttatttt 39118813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149207 times since January 2019
Visitors: 1516