View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_22 (Length: 252)

Name: NF1565_low_22
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_22
[»] chr2 (1 HSPs)
chr2 (18-236)||(43742919-43743131)

Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 43742919 - 43743131
18 acaacttagtactttgaagagtttacatcaatgataagatatttgatgtagtacggagtttactcacacaaagagaatgatgacgtttctagctcaatac 117  Q
    ||||||| |||||||||||||||||||||||||||||||||        ||||| ||||||||||||||| |||||||||||||||||||||||||||||    
43742919 acaacttggtactttgaagagtttacatcaatgataagataca------agtacagagtttactcacacagagagaatgatgacgtttctagctcaatac 43743012  T
118 aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg 217  Q
43743013 aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg 43743112  T
218 ctatttcacatcggaaagt 236  Q
    |||||||| || |||||||    
43743113 ctatttcatatgggaaagt 43743131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142066 times since January 2019
Visitors: 1479