View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_24 (Length: 246)

Name: NF1565_low_24
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_24
NF1565_low_24
[»] chr4 (38 HSPs)
chr4 (1-239)||(16932602-16932839)
chr4 (1-239)||(22781193-22781428)
chr4 (1-239)||(11007024-11007259)
chr4 (1-238)||(9174927-9175162)
chr4 (1-220)||(22045172-22045387)
chr4 (1-231)||(36379595-36379822)
chr4 (59-231)||(16454674-16454846)
chr4 (75-231)||(14788242-14788397)
chr4 (59-231)||(12396607-12396779)
chr4 (59-231)||(12401549-12401721)
chr4 (75-231)||(22801581-22801736)
chr4 (77-231)||(36920344-36920497)
chr4 (1-221)||(5100196-5100412)
chr4 (59-231)||(47564125-47564296)
chr4 (77-230)||(24879882-24880033)
chr4 (82-238)||(22133116-22133271)
chr4 (77-166)||(12396529-12396617)
chr4 (77-166)||(12401471-12401559)
chr4 (40-166)||(3825206-3825331)
chr4 (82-221)||(18535653-18535798)
chr4 (59-158)||(3825321-3825420)
chr4 (75-166)||(16454836-16454926)
chr4 (112-220)||(10114219-10114328)
chr4 (59-221)||(22045036-22045198)
chr4 (177-220)||(12740263-12740306)
chr4 (177-220)||(12748469-12748512)
chr4 (177-220)||(34571132-34571175)
chr4 (65-168)||(3577453-3577557)
chr4 (60-221)||(9174792-9174953)
chr4 (60-221)||(11006889-11007050)
chr4 (75-220)||(36379797-36379941)
chr4 (59-164)||(3577642-3577748)
chr4 (177-221)||(5137687-5137731)
chr4 (59-167)||(16932466-16932573)
chr4 (112-168)||(35371380-35371436)
chr4 (60-221)||(22781057-22781219)
chr4 (59-138)||(18535538-18535612)
chr4 (177-219)||(26559263-26559305)
[»] chr5 (28 HSPs)
chr5 (1-239)||(34477875-34478110)
chr5 (1-239)||(10756482-10756716)
chr5 (1-239)||(31544322-31544556)
chr5 (1-221)||(15355309-15355525)
chr5 (1-221)||(23666649-23666865)
chr5 (59-231)||(18468319-18468491)
chr5 (1-231)||(27911747-27911973)
chr5 (1-238)||(41586746-41586978)
chr5 (1-231)||(18510151-18510378)
chr5 (59-231)||(6746668-6746840)
chr5 (59-221)||(659344-659506)
chr5 (82-219)||(20044298-20044435)
chr5 (59-230)||(20504659-20504829)
chr5 (82-221)||(31466726-31466865)
chr5 (40-166)||(659496-659619)
chr5 (40-166)||(18468481-18468606)
chr5 (40-166)||(6746830-6746955)
chr5 (59-164)||(31466607-31466711)
chr5 (59-166)||(20044448-20044554)
chr5 (40-221)||(27911947-27912127)
chr5 (60-221)||(34477740-34477901)
chr5 (60-221)||(15355173-15355335)
chr5 (60-221)||(23666839-23667001)
chr5 (60-221)||(10756690-10756852)
chr5 (59-221)||(31544530-31544692)
chr5 (185-220)||(42426970-42427005)
chr5 (177-220)||(16408895-16408938)
chr5 (177-220)||(26174374-26174417)
[»] chr1 (37 HSPs)
chr1 (1-239)||(16227756-16227993)
chr1 (1-232)||(47178958-47179185)
chr1 (1-239)||(51751626-51751860)
chr1 (1-231)||(20301728-20301954)
chr1 (40-231)||(27337622-27337812)
chr1 (59-238)||(31736322-31736501)
chr1 (40-231)||(28841954-28842144)
chr1 (5-221)||(31423778-31423990)
chr1 (1-221)||(25249390-25249606)
chr1 (1-231)||(16430262-16430488)
chr1 (82-231)||(14098740-14098889)
chr1 (1-219)||(50077532-50077746)
chr1 (59-231)||(25127121-25127293)
chr1 (75-231)||(28202170-28202325)
chr1 (75-194)||(6996879-6996997)
chr1 (40-166)||(31736207-31736332)
chr1 (40-221)||(20301928-20302109)
chr1 (76-166)||(25127283-25127372)
chr1 (59-159)||(14098621-14098720)
chr1 (59-220)||(13126200-13126359)
chr1 (102-220)||(13548139-13548257)
chr1 (40-221)||(31423623-31423800)
chr1 (1-56)||(28997360-28997414)
chr1 (1-56)||(29003076-29003130)
chr1 (177-220)||(776667-776710)
chr1 (177-220)||(28221583-28221626)
chr1 (82-197)||(50077420-50077534)
chr1 (40-167)||(51751889-51752015)
chr1 (184-220)||(28221961-28221997)
chr1 (60-167)||(16228022-16228128)
chr1 (102-165)||(31928726-31928788)
chr1 (65-138)||(47179243-47179315)
chr1 (1-49)||(8953993-8954040)
chr1 (177-220)||(50167881-50167924)
chr1 (40-197)||(16430486-16430640)
chr1 (111-165)||(19753623-19753677)
chr1 (152-221)||(8954014-8954083)
[»] chr3 (47 HSPs)
chr3 (1-239)||(6064249-6064484)
chr3 (1-239)||(457474-457708)
chr3 (1-238)||(10956805-10957038)
chr3 (1-239)||(11169669-11169903)
chr3 (1-239)||(5898980-5899216)
chr3 (82-231)||(43227656-43227805)
chr3 (1-231)||(43422209-43422435)
chr3 (59-238)||(42991567-42991746)
chr3 (59-221)||(4309022-4309184)
chr3 (1-238)||(53916412-53916645)
chr3 (82-238)||(35918713-35918869)
chr3 (59-231)||(18097624-18097796)
chr3 (1-231)||(890643-890870)
chr3 (59-231)||(28138033-28138205)
chr3 (40-168)||(35918575-35918702)
chr3 (75-219)||(3315988-3316131)
chr3 (84-231)||(28100825-28100972)
chr3 (40-166)||(4308907-4309032)
chr3 (40-164)||(43227820-43227943)
chr3 (40-166)||(28100687-28100810)
chr3 (40-166)||(42991736-42991861)
chr3 (40-166)||(18097511-18097634)
chr3 (40-166)||(28137920-28138043)
chr3 (60-221)||(6064114-6064275)
chr3 (75-221)||(53916294-53916438)
chr3 (1-56)||(3306223-3306277)
chr3 (75-221)||(3306251-3306396)
chr3 (59-221)||(43422076-43422235)
chr3 (59-168)||(23636418-23636526)
chr3 (40-167)||(7607052-7607178)
chr3 (40-221)||(11169877-11170056)
chr3 (75-221)||(457682-457828)
chr3 (177-220)||(15824389-15824432)
chr3 (173-220)||(29812463-29812510)
chr3 (177-220)||(37407853-37407896)
chr3 (102-165)||(43402878-43402940)
chr3 (76-220)||(10956686-10956830)
chr3 (177-221)||(10210793-10210837)
chr3 (177-220)||(5258853-5258896)
chr3 (149-221)||(4599219-4599292)
chr3 (190-231)||(23635058-23635099)
chr3 (177-213)||(7763856-7763892)
chr3 (177-221)||(10057840-10057884)
chr3 (177-221)||(10060062-10060106)
chr3 (177-221)||(10062284-10062328)
chr3 (177-221)||(10064506-10064550)
chr3 (177-221)||(10066728-10066772)
[»] chr7 (32 HSPs)
chr7 (4-239)||(31156744-31156976)
chr7 (1-239)||(1047745-1047979)
chr7 (1-231)||(43845-44071)
chr7 (1-239)||(22136401-22136635)
chr7 (1-239)||(40551428-40551662)
chr7 (1-239)||(7350109-7350343)
chr7 (59-231)||(20298585-20298757)
chr7 (59-239)||(28486862-28487042)
chr7 (59-238)||(7092971-7093150)
chr7 (1-231)||(9679980-9680206)
chr7 (86-231)||(21679383-21679528)
chr7 (59-231)||(7470827-7470999)
chr7 (75-219)||(44726256-44726399)
chr7 (90-231)||(38395609-38395747)
chr7 (42-166)||(38395768-38395891)
chr7 (59-166)||(20298747-20298854)
chr7 (40-166)||(7470712-7470837)
chr7 (40-166)||(28487032-28487157)
chr7 (75-166)||(20298844-20298934)
chr7 (40-166)||(7092856-7092981)
chr7 (59-165)||(21679546-21679651)
chr7 (40-221)||(24815808-24815985)
chr7 (60-219)||(7349974-7350133)
chr7 (59-221)||(1047609-1047771)
chr7 (60-167)||(22136664-22136770)
chr7 (60-167)||(40551691-40551797)
chr7 (177-220)||(48490999-48491042)
chr7 (83-165)||(4509673-4509753)
chr7 (83-165)||(4511515-4511595)
chr7 (177-219)||(47674669-47674711)
chr7 (75-167)||(31156621-31156712)
chr7 (177-221)||(6593062-6593106)
[»] chr6 (14 HSPs)
chr6 (1-239)||(33310477-33310711)
chr6 (1-238)||(26066854-26067087)
chr6 (1-221)||(3630662-3630878)
chr6 (1-219)||(3395639-3395853)
chr6 (82-231)||(15533450-15533600)
chr6 (59-219)||(30729457-30729616)
chr6 (60-166)||(15533332-15533437)
chr6 (75-221)||(3630543-3630688)
chr6 (83-168)||(26944710-26944794)
chr6 (60-221)||(33310685-33310846)
chr6 (60-221)||(26066719-26066880)
chr6 (59-167)||(3395882-3395989)
chr6 (60-168)||(11137783-11137892)
chr6 (177-221)||(34166479-34166523)
[»] chr2 (17 HSPs)
chr2 (1-239)||(35216426-35216660)
chr2 (1-239)||(19502792-19503026)
chr2 (1-239)||(36559601-36559835)
chr2 (90-230)||(21519181-21519321)
chr2 (1-221)||(31733620-31733836)
chr2 (114-231)||(6263002-6263119)
chr2 (59-164)||(21519054-21519158)
chr2 (59-168)||(22405147-22405255)
chr2 (77-218)||(13828965-13829105)
chr2 (14-118)||(6259708-6259808)
chr2 (60-221)||(36559466-36559627)
chr2 (177-220)||(14634529-14634572)
chr2 (59-221)||(19502656-19502818)
chr2 (40-197)||(31733468-31733622)
chr2 (15-56)||(22405281-22405321)
chr2 (77-221)||(35216308-35216452)
chr2 (59-194)||(6259561-6259694)
[»] chr8 (15 HSPs)
chr8 (1-239)||(43081245-43081479)
chr8 (1-239)||(27828629-27828849)
chr8 (82-231)||(15072127-15072276)
chr8 (1-231)||(41384022-41384248)
chr8 (59-166)||(15072289-15072395)
chr8 (40-221)||(27828823-27829004)
chr8 (128-221)||(21481856-21481949)
chr8 (1-57)||(18812371-18812426)
chr8 (65-220)||(17849263-17849416)
chr8 (111-219)||(31574411-31574521)
chr8 (177-220)||(4733225-4733268)
chr8 (173-220)||(41365542-41365589)
chr8 (75-221)||(43081453-43081599)
chr8 (177-220)||(34255036-34255079)
chr8 (59-197)||(41384246-41384383)
[»] scaffold0140 (2 HSPs)
scaffold0140 (1-221)||(23730-23946)
scaffold0140 (60-221)||(23920-24082)
[»] scaffold1674 (2 HSPs)
scaffold1674 (59-239)||(298-478)
scaffold1674 (42-166)||(185-308)
[»] scaffold0025 (2 HSPs)
scaffold0025 (82-238)||(70061-70217)
scaffold0025 (40-166)||(69922-70048)
[»] scaffold0005 (1 HSPs)
scaffold0005 (75-231)||(51333-51488)
[»] scaffold0011 (1 HSPs)
scaffold0011 (75-221)||(35220-35365)
[»] scaffold0133 (2 HSPs)
scaffold0133 (65-221)||(4107-4269)
scaffold0133 (84-138)||(4293-4346)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-57)||(189151-189206)
[»] scaffold0250 (1 HSPs)
scaffold0250 (1-51)||(2348-2397)
[»] scaffold1899 (1 HSPs)
scaffold1899 (196-239)||(1213-1256)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 38)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 16932602 - 16932839
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||    
16932602 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctcataaccacttcagccatcggaatatcttccgccttctcgaaga 16932700  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||| ||||||||||||||||||    
16932701 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacacaggacatctcccgcttccttgaagatcacc 16932800  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
16932801 ttgcatccaatcacccttggcattcttttagagtaatct 16932839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 22781193 - 22781428
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||  || | ||||| ||| |||||| |||||||||||||||||||    
22781193 atctacttgtactcaatcacccttggctttt-agagtaatccacaagtatacacctc--aatcccttcagccatcggaatgtcttccgccttctcgaaga 22781289  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
22781290 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcctgcttccttgaagatcacc 22781389  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
22781390 ttgcatccaatcacccttggcattcttttagagtaatct 22781428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11007024 - 11007259
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||| ||| | ||||||||||||||||||||||||    
11007024 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccacttcagccatcagaatatcttccgccttctcgaaga 11007120  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||| ||||||||||||||||    
11007121 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacacagaacatctcctggttccttgaagatcacc 11007220  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||||||||||||| |||||||||||| ||||||    
11007221 ttgcatccaatcacccttgacattcttttagagtaatct 11007259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 9174927 - 9175162
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||| ||  |||||||||||||||||||||||||     
9174927 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcagccctcggaatatcttccgccttctcgaag- 9175022  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
9175023 gtccttgcagtccaactacactaggaattttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcccgcttccttgaagatcacc 9175122  T
201 ttgcatccaatca--cccttggcattcttttagaataatc 238  Q
    |||||||||||||  |||||||| ||||||||| ||||||    
9175123 ttgcatccaatcacccccttggccttcttttaggataatc 9175162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 22045172 - 22045387
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
22045172 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 22045267  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||    
22045268 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaccgcagaacatctcccgcttccttgaagatcacc 22045367  T
201 ttgcatccaatcacccttgg 220  Q
    |||||| |||||||||||||    
22045368 ttgcattcaatcacccttgg 22045387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36379822 - 36379595
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||  ||||| ||| | ||| ||||||   ||||| ||||||||||     
36379822 atctacttgtgcccaatcacccttggatttttagggtaatccacaagtatacacct--taacccctttagccatcggaatgatttccgtcttctcgaag- 36379726  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||| || | | ||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| ||||||||||||||||||    
36379725 gtccttgcagtccaactacgctggcaattttaggtagttccacaagcattcaccataacatcttcaacacaagacatctcccgcttccttgaagatcacc 36379626  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    |||||| |||||||||||||| || ||||||    
36379625 ttgcattcaatcacccttggcctttttttag 36379595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 16454846 - 16454674
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  | |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
16454846 taacctcttcagccatcggaacgttttccgccttctcaaagagtccttgcagtccaactacactaggagttttaggtagttccacaagcattcaccataa 16454747  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||||| ||  |||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||    
16454746 catcttcaacacaggacatctcccgcttccttgaagatcaccttgcatccaatcacccttggcctttttttag 16454674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 75 - 231
Target Start/End: Original strand, 14788242 - 14788397
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |    
14788242 cggaatgtcttccgccttctcgaag-gtccttgcagtccatctacactaggaattttaggtagttccacaagcattcaccataacatcttcaacacagga 14788340  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||    
14788341 catctcccgcttccttgaagatcaccttgcatccaatcacccttggcctttttttag 14788397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 12396607 - 12396779
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  |||| || |||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
12396607 taacctcttcagccatcggaacgtctttcgtcttctctaagagtccttgcagtccaactacactaggagttttaggcagttccacaagcattcaccataa 12396706  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||| | ||  ||||||| ||||||||||||||||||||| |||||||||||||||||| || ||||||    
12396707 catcttcaccacaggacatctcatgcttccttgaagatcaccttacatccaatcacccttggcctttttttag 12396779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 12401549 - 12401721
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  |||| || |||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
12401549 taacctcttcagccatcggaacgtctttcgtcttctctaagagtccttgcagtccaactacactaggagttttaggcagttccacaagcattcaccataa 12401648  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||| | ||  ||||||| ||||||||||||||||||||| |||||||||||||||||| || ||||||    
12401649 catcttcaccacaggacatctcatgcttccttgaagatcaccttacatccaatcacccttggcctttttttag 12401721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 75 - 231
Target Start/End: Original strand, 22801581 - 22801736
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||  |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||  |    
22801581 cggaatgtcttccgccttctcgaat-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccataacatcttcaacgcagga 22801679  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||| |||||||||||| |  ||||||||||||||||||||||| || ||||||    
22801680 catctcccgcttccttgaaggtttccttgcatccaatcacccttggcctttttttag 22801736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 231
Target Start/End: Original strand, 36920344 - 36920497
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataaca 176  Q
    |||| |||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||  |||||||| ||  |||    
36920344 gaatgtcttccgccttctcgaag-gtccttgcagtccaactacgctaggaattttaggtagttccacaagcattcaccataatctcttcaacacaggaca 36920442  T
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||||||||||||| || ||||||||||||||||||||||| || ||||||    
36920443 tctcctgcttccttgaaggtctccttgcatccaatcacccttggcctttttttag 36920497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5100412 - 5100196
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| || ||||||||||||||||| ||||||||| ||||||||||||||  ||| | ||||| ||  |||||||||||  | ||||||||||     
5100412 atctacttgtgcctaatcacccttggctttt-agagtaatcaacaagtatacacct--taatcccttcagccctcggaatatcttgtgtcttctcgaag- 5100317  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||| || || ||  |||||  ||||||||||| | ||||||||||||||||||||||||||||||  |||||||| ||||||||||||||| ||    
5100316 gtccttgcaatctaattatgctaggtattttaggtagttcaacaagcattcaccataacatcttcaacgcaggacatctcccgcttccttgaagatctcc 5100217  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||| ||||||    
5100216 ttgcatccaatcactcttggc 5100196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 47564296 - 47564125
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||||||  ||||||||||||||||||    
47564296 taaccccttcagccatcagaatattttccgccttctcgaag-gtccttgcagtccaactacgctaggaattttaggtagtttcacaagcattcaccataa 47564198  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    | |||||||| ||  |||| ||| ||||||||||| ||  ||||||||||||||||||||||| || ||||||    
47564197 cctcttcaacacaatacatttcccgcttccttgaaaatttccttgcatccaatcacccttggcctttttttag 47564125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 77 - 230
Target Start/End: Complemental strand, 24880033 - 24879882
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataaca 176  Q
    |||| |||||| ||||||||||| ||||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||||||||||||| ||  |||    
24880033 gaatgtcttccaccttctcgaag-gtccttgcagtccaactactctaggaattttaggtagttccacaagcattcatcataacatcttcaacacaggaca 24879935  T
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggcattctttta 230  Q
    ||||| |||||| |||| || |||||||||||||||||||||||| || |||||    
24879934 tctcccgcttcc-tgaatattaccttgcatccaatcacccttggccttttttta 24879882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 82 - 238
Target Start/End: Original strand, 22133116 - 22133271
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||  |   ||||||||    
22133116 tcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataacctcttcaatacgagacatctcc 22133214  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
     ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
22133215 cgcttccttgaagatcaccttgcatccaatcacccttggccttcttttaggataatc 22133271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 77 - 166
Target Start/End: Original strand, 12396529 - 12396617
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttca 166  Q
    |||| |||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| ||||||||||||||| |||| ||||||    
12396529 gaatgtcttccgccttctcgaag-gtccttgcagtccaactaaactaggaattttaggtagttccacaagcattcaccttaacctcttca 12396617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 77 - 166
Target Start/End: Original strand, 12401471 - 12401559
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttca 166  Q
    |||| |||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| ||||||||||||||| |||| ||||||    
12401471 gaatgtcttccgccttctcgaag-gtccttgcagtccaactaaactaggaattttaggtagttccacaagcattcaccttaacctcttca 12401559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 3825206 - 3825331
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||| | ||| | ||||| ||  | |||| |||||||||||||||||| |||||||||||||||||| |||| || |||||||||||     
3825206 tccacaagtttacaccccttaaacccttcagccctcagaatgtcttccgccttctcgaag-gtccttgcagtccaactatactatgaattttaggtagtt 3825304  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
3825305 ccacaagcattcaccttaacctcttca 3825331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 82 - 221
Target Start/End: Original strand, 18535653 - 18535798
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccaca-------agcattcaccataacatcttcaacgcataa 174  Q
    |||||||| |||| |||||| |||||||||||||||||||||||| ||||| ||||| |||||       || || ||||||||| |||||||| |   |    
18535653 tcttccgcgttctagaagag-ccttgcagtccaactacactaggaattttatgtagttccacattccacaagtatccaccataacctcttcaacacggga 18535751  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    |||||||  |||||||||||||| |||||||||||||||||||||||    
18535752 catctcccacttccttgaagatctccttgcatccaatcacccttggc 18535798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 59 - 158
Target Start/End: Original strand, 3825321 - 3825420
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||||||||||| ||||  |||| | || ||||||||||||||    
3825321 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagatttatatagttctacgagcattcaccataa 3825420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 75 - 166
Target Start/End: Complemental strand, 16454926 - 16454836
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttca 166  Q
    |||||| ||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |||||| |||||||| |||| ||||||    
16454926 cggaatgtcttctgccttctcgaag-gtccttgcagtccaactacactaagaattttaggtagttccacaaacattcaccttaacctcttca 16454836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 112 - 220
Target Start/End: Complemental strand, 10114328 - 10114219
Alignment:
112 ccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaa-cgcataacatctcctgcttccttgaagatcaccttgcatccaa 210  Q
    ||||||||||||||| ||||||||||| ||||||| ||  |||||||| ||||||| | |  ||| ||||| ||||||||||||||| |||| |||||||    
10114328 ccaactacactaggaattttaggtagttccacaagtatataccataacctcttcaaccacggaacgtctcccgcttccttgaagatctccttccatccaa 10114229  T
211 tcacccttgg 220  Q
    ||||||||||    
10114228 tcacccttgg 10114219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 22045036 - 22045198
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||    
22045036 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataa 22045134  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
22045135 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 22045198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 12740263 - 12740306
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
12740263 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 12740306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 12748469 - 12748512
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
12748469 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 12748512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 34571132 - 34571175
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
34571132 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 34571175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 65 - 168
Target Start/End: Original strand, 3577453 - 3577557
Alignment:
65 cttcacccaccggaatatcttccgccttctcgaagag--tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatc 162  Q
    ||||| ||| |||||| ||||||||||||| |||||   |||||||| |||||||||||||||| ||||||||||| ||| |||  | ||||||||| ||    
3577453 cttcaaccatcggaatgtcttccgccttcttgaagacaatccttgca-tccaactacactaggaattttaggtagttccataagtctacaccataacctc 3577551  T
163 ttcaac 168  Q
    ||||||    
3577552 ttcaac 3577557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 9174792 - 9174953
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||| ||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
9174792 aacctcttcagccatcggaatgtcttctgccttctcgaaga-tgcttggagtccaactacgctaggaatttcaggtagttctacaagactataccataac 9174890  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
9174891 ctcttcaatacgagatatctccagctttccttgaagatctacttgtacccaatcacccttggc 9174953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 11006889 - 11007050
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||||||||| ||||||||||||| | |||| ||| ||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
11006889 aacctcttcagccatcggaatatcttctgccttctcgaaga-tgcttgtagttcaactacgctaggaatttcaggtagttctacaagactataccataac 11006987  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
11006988 ctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 11007050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 220
Target Start/End: Complemental strand, 36379941 - 36379797
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| ||||| ||||||||||||| |||||| |  | ||||||||||||| ||| | ||| | | |||||  |  |||||||| |||||||  || ||    
36379941 cggaatgtcttctgccttctcgaaga-tccttgtatccaaactacactaggaatttcaagtaattctacaagactataccataacctcttcaatacagaa 36379843  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||||| |||||||||||||||  ||||   ||||||||||||||    
36379842 catctcccgcttccttgaagatctacttgtgcccaatcacccttgg 36379797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 164
Target Start/End: Original strand, 3577642 - 3577748
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagag--tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccat 156  Q
    ||||| ||||| ||| ||||||  |||||| ||||| |||||   |||||||| |||||||||||||||| ||||||||||| |||||||  | ||||||    
3577642 taacctcttcaaccatcggaatgccttccgacttcttgaagatcatccttgca-tccaactacactaggaattttaggtagttccacaagtctacaccat 3577740  T
157 aacatctt 164  Q
    ||| ||||    
3577741 aacctctt 3577748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 5137731 - 5137687
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || ||||||||||||||||||||||| ||||||||||||    
5137731 tctcccgcctccttgaagatcaccttgcatccgatcacccttggc 5137687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 167
Target Start/End: Original strand, 16932466 - 16932573
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||| ||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||    
16932466 taacctcttcagccatcggaatgtcttccgtcttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataa 16932564  T
159 catcttcaa 167  Q
    | |||||||    
16932565 cctcttcaa 16932573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 35371380 - 35371436
Alignment:
112 ccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaac 168  Q
    ||||||| ||||||| ||||||||||| |||||||  | ||||||||||||||||||    
35371380 ccaactatactaggacttttaggtagttccacaagtttacaccataacatcttcaac 35371436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 22781057 - 22781219
Alignment:
60 aaccacttcacccaccggaatatcttcc-gccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    |||| ||||| ||| |||||| |||||| ||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||    
22781057 aacctcttcagccatcggaatgtcttcccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataa 22781155  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| |  ||||||||||||||    
22781156 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtactcaatcacccttggc 22781219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 138
Target Start/End: Original strand, 18535538 - 18535612
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagt 138  Q
    ||||| ||||| ||| |||||| |||||||||||||||||| ||||||| |||||    ||||||||| |||||||||||    
18535538 taaccccttcagccatcggaatgtcttccgccttctcgaag-gtccttgtagtcc----acactaggaattttaggtagt 18535612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 26559305 - 26559263
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
    ||||| |||||| |||||||| |||||||||||||||||||||    
26559305 tctcccgcttccgtgaagatctccttgcatccaatcacccttg 26559263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 28)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 34477875 - 34478110
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||| | | | ||||||||||||||||||||||||    
34477875 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccacttcagctatcagaatatcttccgccttctcgaaga 34477971  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34477972 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 34478071  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
34478072 ttgcatccaatcacccttggcattcttttagagtaatct 34478110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 10756716 - 10756482
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||| ||| |||||||||||||||||||||||||     
10756716 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccacttcagccatcggaatatcttccgccttctcgaag- 10756621  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| | ||||||||||||||||||    
10756620 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcaacgcataacatcttccgcttccttgaagatcacc 10756521  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
10756520 ttgcatccaatcacccttggcattcttttagagtaatct 10756482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 31544556 - 31544322
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||  |||||||||| ||| |||||||||||||||||||||||||     
31544556 atctacttgtacccaatcacccttggctttt-agagtaatctacaagtatacacctc--aaccacttcagccatcggaatatcttccgccttctcgaag- 31544461  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| ||    
31544460 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacacagaacatctcctgcttccttgaagatctcc 31544361  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||||||||| ||||  |||||||||| ||||||    
31544360 ttgcatccaatcaccattggtcttcttttagagtaatct 31544322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 15355309 - 15355525
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
15355309 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 15355404  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| ||||||||| ||||||||||||||||||    
15355405 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcagcgcagaacatctcccgcttccttgaagatcacc 15355504  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||| ||||||    
15355505 ttgcatccaatcactcttggc 15355525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 23666865 - 23666649
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
23666865 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 23666770  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| ||||||||| ||||||||||||||||||    
23666769 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcagcgcagaacatctcccgcttccttgaagatcacc 23666670  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||| ||||||    
23666669 ttgcatccaatcactcttggc 23666649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 18468491 - 18468319
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18468491 taacctcttcagccatcggaacatcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 18468392  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||| ||| ||||||||  ||||||||||||||||||||||||| ||||||||||||| |||||||||    
18468391 catcttcaatgcaaaacatctctcgcttccttgaagatcaccttgcatctaatcacccttggccttcttttag 18468319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 27911973 - 27911747
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||| ||  |||||| ||||||||||||||||||     
27911973 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcagccctcggaatgtcttccgccttctcgaag- 27911878  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||  ||||||||   |||||||||| || ||    
27911877 gtccttgcagtctaactacactaggaattttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccagttccttgaaggtctcc 27911778  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||||||||||| || ||||||    
27911777 ttgcatccaatcacccttggcctttttttag 27911747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 41586746 - 41586978
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||| ||||  ||||||||||||||||| ||||||  ||||| ||||| ||  |||||| ||||||||||||||||||     
41586746 atctacttgtgcccaatcacccttgtcttt--agagtaatccacaagtacacacct--taaccccttcagccctcggaatgtcttccgccttctcgaag- 41586840  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| |||||||||||| || ||    
41586841 gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccgcttccttgaaggtctcc 41586940  T
201 ttgcatccaatcacccttggcattcttttagaataatc 238  Q
    ||||||||||||||||||||| |  ||||||| |||||    
41586941 ttgcatccaatcacccttggcctctttttagagtaatc 41586978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 18510151 - 18510378
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| | |||||||||||||||||| ||||||||||||||||||||||||   |||| ||||| ||| |||||| ||||||||||||||||||     
18510151 atctacttgtgctcaatcacccttggctttt-agagtaatccacaagtatacacctta-aaccccttcagccatcggaatgtcttccgccttctcgaag- 18510247  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||| |||||| |||||  ||||||||||| ||||||||||||||||||||||||||||||||  |||||||| ||||||||||||||| ||    
18510248 gtccttgcagtctaactacgctaggtattttaggtagttccacaagcattcaccataacatcttcaacgcaggacatctcccgcttccttgaagatctcc 18510347  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    |||| |||||||||||||||| || ||||||    
18510348 ttgcctccaatcacccttggcctttttttag 18510378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 6746840 - 6746668
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||    
6746840 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacgctaggatttttaggtagtcccacaagcattcaccacaa 6746741  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||||||||  |||||||||||||| |||||| |||||||||||||||||||||||||  |||||||||    
6746740 catcttcaacgcaggacatctcctgcttctttgaaggtcaccttgcatccaatcacccttggtcttcttttag 6746668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 659506 - 659344
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||    
659506 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgtagtccaactacactaggagttttaggtagttccacaaacattcaccataa 659407  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    |||||||||| ||  |||||||| |||||||||||| || |||||||||||||||||||||||    
659406 catcttcaacacaggacatctcccgcttccttgaaggtctccttgcatccaatcacccttggc 659344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 82 - 219
Target Start/End: Complemental strand, 20044435 - 20044298
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||  ||||||||    
20044435 tcttccgccttctcgaagagtccttgcagtccaactacactagaagttttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcc 20044336  T
182 tgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
     |||||||||||| |  |||||||||||||||||||||    
20044335 cgcttccttgaaggtttccttgcatccaatcacccttg 20044298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 59 - 230
Target Start/End: Original strand, 20504659 - 20504829
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||| |||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||    
20504659 taacctcttcagccatcagaatgtcttcctccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccataa 20504757  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattctttta 230  Q
    | |||||||| ||  |||||||| |||||||| ||| || |||||||||||||| ||||||||||| |||||    
20504758 cctcttcaacacaggacatctcccgcttccttaaaggtctccttgcatccaatcccccttggcattttttta 20504829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 82 - 221
Target Start/End: Original strand, 31466726 - 31466865
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| |||||||||||||||||| |||||||||||||||||||  ||| ||||| ||||||||||||||||| | ||||||||| ||  ||||||||    
31466726 tcttccgtcttctcgaagagtccttgtagtccaactacactaggagaattatgtagttccacaagcattcaccatgaaatcttcaacacaggacatctcc 31466825  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
      ||| ||||||| || |||||||||||||||||||||||    
31466826 cactttcttgaaggtctccttgcatccaatcacccttggc 31466865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 659619 - 659496
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||  ||||| ||||| ||| |||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||     
659619 tccacaagtttacacct--taaccccttcaaccatcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagtt 659523  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
659522 ccacaagcattcaccttaacctcttca 659496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 18468606 - 18468481
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||| ||| ||||| ||||| ||  |||||| |||||||||||||| ||| ||||||| |||||||| ||||||||||||||||||||||    
18468606 tccacaagtttacagctcataaccccttcagccctcggaatgtcttccgccttctcaaag-gtccttgtagtccaacaacactaggagttttaggtagtc 18468508  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||  |||| ||||||    
18468507 ccacaagcattcactttaacctcttca 18468481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 6746955 - 6746830
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  | |||| |||||||||||||||||| |||||| |||||||||||| |||||| |||||||||||     
6746955 tccacaagtttacacctcttaaccccttcagccctcagaatgtcttccgccttctcgaag-gtccttacagtccaactacgctaggaattttaggtagtt 6746857  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||  |||| ||||||    
6746856 ccacaagcattcactttaacctcttca 6746830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 59 - 164
Target Start/End: Original strand, 31466607 - 31466711
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||| |||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||||||| |||    
31466607 taaccccttcagccatcagaatgtcttccgccttctcgaag-gtccttgcagtccaactacaataggaattttaggtagttccacaagcattcaccttaa 31466705  T
159 catctt 164  Q
    | ||||    
31466706 cctctt 31466711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 59 - 166
Target Start/End: Complemental strand, 20044554 - 20044448
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| ||||||  ||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||| ||||||||||||||  |||    
20044554 taaccccttcagccatcggaatgacttccgccttctcgaag-gtccttgcagtccaactacaccaggaattttaggtagttccacaagcattcactttaa 20044456  T
159 catcttca 166  Q
    | ||||||    
20044455 cctcttca 20044448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 221
Target Start/End: Complemental strand, 27912127 - 27911947
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||| |||||| ||||||||||||||||||| | |||| |||| |||||| |||||| ||| |||||||     
27912127 tccacaagtttacacctcttaacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtcaaactacgctaggaatttcaggtagtt 27912029  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||  |  |||||||| |||||||  |   ||||||||  || |||||||||||  ||||   |||||||||||||||    
27912028 ctacaagactataccataacctcttcaatacgagacatctcccactaccttgaagatctacttgtgcccaatcacccttggc 27911947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 34477740 - 34477901
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||||| |||||  |  ||||||||    
34477740 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagtcctacaagactataccataac 34477838  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
34477839 ctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 34477901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 15355173 - 15355335
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaag-cattcaccataa 158  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | ||||| | |  |||||||    
15355173 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagacttataccataa 15355271  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
15355272 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 15355335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Complemental strand, 23667001 - 23666839
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaag-cattcaccataa 158  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | ||||| | |  |||||||    
23667001 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagacttataccataa 23666903  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
23666902 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 23666839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 221
Target Start/End: Complemental strand, 10756852 - 10756690
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaag-cattcaccataa 158  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | ||||| | |  |||||||    
10756852 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagacttataccataa 10756754  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
10756753 cctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 10756690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 31544692 - 31544530
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| |||| || | |||||  |  |||||||    
31544692 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtggttctacaagactataccataa 31544594  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
31544593 cctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 31544530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 220
Target Start/End: Original strand, 42426970 - 42427005
Alignment:
185 ttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||||||||||||||||||||||||||||||||||    
42426970 ttccttgaagatcaccttgcatccaatcacccttgg 42427005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 16408938 - 16408895
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||| |||||||||||||||||| |||||||||||    
16408938 tctcccgcttcctcgaagatcaccttgcatccgatcacccttgg 16408895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 26174417 - 26174374
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||| |||||||||||||||||| |||||||||||    
26174417 tctcccgcttcctcgaagatcaccttgcatccgatcacccttgg 26174374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 37)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 16227993 - 16227756
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||| | ||||||||||||||||||||||||    
16227993 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctcataaccacttcagccatcagaatatcttccgccttctcgaaga 16227895  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||| ||||||||||||||||||    
16227894 gtccttgtagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacacaggacatctcccgcttccttgaagatcacc 16227795  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
16227794 ttgcatccaatcacccttggcattcttttagagtaatct 16227756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 47179185 - 47178958
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||| ||| |||||||||||||||||||||||||     
47179185 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccacttcagccatcggaatatcttccgccttctcgaag- 47179090  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||    
47179089 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacacagaacatctcctgcttccttgaagatcacc 47178990  T
201 ttgcatccaatcacccttggcattcttttaga 232  Q
    ||||||||||||||||||||||||||||||||    
47178989 ttgcatccaatcacccttggcattcttttaga 47178958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 51751860 - 51751626
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||  |||| ||||| ||| |||||| ||||||||||||||||||     
51751860 atctacttgtacccaatcaccattggctttt-agagtaatccataagtatacacctc--aaccccttcagccatcggaatgtcttccgccttctcgaag- 51751765  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||| ||||||||||| |||||| ||| ||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
51751764 gtccttgtagtccaactacgctaggaatttcaggtagttctacaagcattcaccataacatcttcaacgcagaacatctcccgcttccttgaagatcacc 51751665  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
51751664 ttgcatccaatcacccttggcattcttttagagtaatct 51751626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 20301954 - 20301728
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||  ||||| ||||| ||  |||||| ||||||||||||||||||     
20301954 atctacttgtacccaatcacccttggctttt-agagtaattcacaagtatacacct--taaccccttcagccctcggaatgtcttccgccttctcgaag- 20301859  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||| |||||||| |||||| |||||| ||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |||||||||    
20301858 gtccttgcagcccaactacgctaggaattttagttagtcccacaagcattcaccataacatcttcaatgcaaaacatctcccgcttccttaaagatcacc 20301759  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||||||||||| |||||||||    
20301758 ttgcatccaatcacccttggccttcttttag 20301728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 40 - 231
Target Start/End: Original strand, 27337622 - 27337812
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
27337622 tccacaagtttacacctcttaacctcttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggagttttaggtagtc 27337720  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    | ||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
27337721 ctacaagcattcaccataacatcttcaacgcaggacatctcccgcttccttgaagatcaccttgcatccaatcacccttggccttcttttag 27337812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 59 - 238
Target Start/End: Original strand, 31736322 - 31736501
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31736322 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 31736421  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
    |||||||||||||  |||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||| |||||    
31736422 catcttcaacgcaggacatctcccgcttccttgaagatcaccttgcatcctatcacccttggccttcttttagagtaatc 31736501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 40 - 231
Target Start/End: Complemental strand, 28842144 - 28841954
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    |||||||||  ||||||| | ||| ||||| ||  |||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||     
28842144 tccacaagttaacacctcatgaccccttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagtt 28842046  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||| | |||||||||||||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
28842045 ccacaagcgtacaccataacatcttcaacgcaggacatctcccgcttccttgaagatcaccttgcatccaatcacccttggccttcttttag 28841954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 31423778 - 31423990
Alignment:
5 acttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtcc 104  Q
    |||||| |||||||||||||||||||| || |||||||||||||| |||||   ||||| ||||| ||  |||||| |||||||||||||||||| ||||    
31423778 acttgtgcccaatcacccttggcttttaag-gtaatccacaagtacacacca--taaccccttcagccctcggaatgtcttccgccttctcgaag-gtcc 31423873  T
105 ttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgc 204  Q
    || ||||||||||||||||| | ||||||||||| |||||||||||||||||||  |||||||| ||  |||||||| ||||||||||||||||||||||    
31423874 ttacagtccaactacactagaaattttaggtagttccacaagcattcaccataatctcttcaacacaggacatctcccgcttccttgaagatcaccttgc 31423973  T
205 atccaatcacccttggc 221  Q
    |||||||||||||||||    
31423974 atccaatcacccttggc 31423990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 25249390 - 25249606
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||  |||||  ||| | ||||| ||  |||||| |||| | |||||||||||     
25249390 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtacgcacct--taaacccttcagccctcggaatgtctttcaccttctcgaag- 25249485  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||| ||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| ||||| |||||||||| |    
25249486 gtcgttgcagtccaactacgctaggaattttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccgcttctttgaagatcatc 25249585  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||||||||||    
25249586 ttgcatccaatcacccttggc 25249606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 16430488 - 16430262
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||| |||| |||||||||||| ||||||| || ||||| |||||||| ||||||  ||||| ||||| ||| | |||| | ||||||||||||||||     
16430488 atctatttgttcccaatcaccctaggctttt-agggtaattcacaagtacacacct--taaccccttcagccatcagaatgtgttccgccttctcgaag- 16430393  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||| |||||| |||||| ||||||||||| |||||||||||||||||||| |||||||| ||  |||||||| ||||||||||||||| ||    
16430392 gtccttgcagtctaactacgctaggaattttaggtagttccacaagcattcaccataacctcttcaacacaggacatctcccgcttccttgaagatctcc 16430293  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||||||||||| || ||||||    
16430292 ttgcatccaatcacccttggcctttttttag 16430262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 82 - 231
Target Start/End: Original strand, 14098740 - 14098889
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    |||||||  |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||  ||||||||    
14098740 tcttccgttttctcgaagagtccttgcagtccaactacactaggagttttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcc 14098839  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
     |||||||||||| || ||||||||||||||||||||||| || ||||||    
14098840 cgcttccttgaaggtctccttgcatccaatcacccttggcctttttttag 14098889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 50077532 - 50077746
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |  ||||||| ||||||||| | |||||||||||||||||||| |  ||||| ||||| ||  | |||| ||||||||||||||||||     
50077532 atctacttgtgcttaatcaccattggcttttaa-agtaatccacaagtatacactt--taaccccttcagccctcagaatgtcttccgccttctcgaag- 50077627  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||| ||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||| |   |||||||| ||||||||||||  ||||    
50077628 gtccttgcaatccaactacgctaggaattttaggtagttccacaagcattcaccataacatcttcaacacgggacatctcccgcttccttgaaggccacc 50077727  T
201 ttgcatccaatcacccttg 219  Q
    |||||||||||||||||||    
50077728 ttgcatccaatcacccttg 50077746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 25127293 - 25127121
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||    
25127293 taacctcttcagccatcggaacgtcttccgccttcttgaagagtccttgcagtccaactacactaggagttttaggtagttccacaatcattcaccataa 25127194  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||  |  |||||||| |||||||||||| || |||| |||||||| ||||||||| || ||||||    
25127193 catcttcaacaaaggacatctcccgcttccttgaaggtctccttccatccaattacccttggcctttttttag 25127121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 75 - 231
Target Start/End: Original strand, 28202170 - 28202325
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||| ||  |    
28202170 cggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccataacattttcaacacagga 28202268  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||| |||||||||||| ||  |||||||||||||||||||||| || ||||||    
28202269 catctcccgcttccttgaaggtcttcttgcatccaatcacccttggcctttttttag 28202325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 75 - 194
Target Start/End: Complemental strand, 6996997 - 6996879
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||| ||  |    
6996997 cggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcatttaccataacatcttcaacacagga 6996899  T
175 catctcctgcttccttgaag 194  Q
    ||||||| ||||||||||||    
6996898 catctcccgcttccttgaag 6996879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 31736207 - 31736332
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  |||||| |||||||||||||||||| |||||||||||||||||||  ||||| ||||||||||||    
31736207 tccacaagtttacacctcataaccccttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacgttaggaattttaggtagtc 31736305  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
31736306 ccacaagcattcaccttaacctcttca 31736332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 221
Target Start/End: Complemental strand, 20302109 - 20301928
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||| |||||| ||||||||||||||||||| |||||| ||||||||||| |||||| ||| |||||||     
20302109 tccacaagtttacacctcttaacctcttcagccatcggaatgtcttccgccttctcgaaga-tccttgtagtccaactacgctaggaatttcaggtagtt 20302011  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||  |  |||||||| |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
20302010 ctacaagactataccataacctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 20301928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 76 - 166
Target Start/End: Complemental strand, 25127372 - 25127283
Alignment:
76 ggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttca 166  Q
    ||||| |||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||| ||||||||||||||| |||| ||||||    
25127372 ggaatgtcttccgccttctcgaag-gtctttgcagtccaactacactaggaattttaggtagttccacaagcattcaccttaacctcttca 25127283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 59 - 159
Target Start/End: Original strand, 14098621 - 14098720
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| | |||| |||||||| |||    
14098621 taaccccttcagccatcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttctacaaacattcaccttaa 14098719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 59 - 220
Target Start/End: Original strand, 13126200 - 13126359
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||| ||||||||||| ||||||| |||||||| ||||||||||||| || ||||||||||| |||||||  | ||||||||    
13126200 taacctcttcagccatcagaatgtcttccgccttgtcgaaga-tccttgca-tccaactacactaagaattttaggtagttccacaagtctacaccataa 13126297  T
159 catcttcaacg-cataacatctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    | ||||||||  |  |||||||||  |||||||||||||| ||||||||| ||||||||||||    
13126298 cctcttcaaccacggaacatctccc-cttccttgaagatctccttgcatctaatcacccttgg 13126359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 13548139 - 13548257
Alignment:
102 tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcat--aacatctcctgcttccttgaagatcac 199  Q
    |||||||| |||||||| ||||||| ||||||||||| |||||||| | ||||||||| |||||||| |||  ||| ||||| ||||||||||||||||     
13548139 tccttgca-tccaactaaactaggatttttaggtagttccacaagcctacaccataacctcttcaac-catggaacgtctcccgcttccttgaagatcat 13548236  T
200 cttgcatccaatcacccttgg 220  Q
    ||||||||| |||||||||||    
13548237 cttgcatccgatcacccttgg 13548257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 40 - 221
Target Start/End: Original strand, 31423623 - 31423800
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    |||||||||| ||||||  ||||| ||||| ||| |||||| |||||| | |||||||||| |||||| ||||||||||| |||||| |||||||||||     
31423623 tccacaagtacacacct--taacctcttcagccatcggaatgtcttccacattctcgaaga-tccttgtagtccaactacgctaggaattttaggtagtt 31423719  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||  |  ||||| || |||||||| ||  |||||||| |||||||||||||||  ||||   |||||||||||||||    
31423720 ctacaagactataccat-acttcttcaacacaagacatctcccgcttccttgaagatccacttgtgcccaatcacccttggc 31423800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 28997360 - 28997414
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacct 56  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
28997360 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct 28997414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 29003076 - 29003130
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacct 56  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
29003076 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct 29003130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 776710 - 776667
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
776710 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 776667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 28221583 - 28221626
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
28221583 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 28221626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 82 - 197
Target Start/End: Original strand, 50077420 - 50077534
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| ||||||||||| |||||| ||||||||||| |||||| ||||||||||| | |||||  |  |||||||| |||| ||  ||  ||||||||    
50077420 tcttccgtcttctcgaaga-tccttgtagtccaactacgctaggaattttaggtagttctacaagactataccataacctcttaaatacaggacatctcc 50077518  T
182 tgcttccttgaagatc 197  Q
     |||||||||||||||    
50077519 cgcttccttgaagatc 50077534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 40 - 167
Target Start/End: Complemental strand, 51752015 - 51751889
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  | |||| |||||||||||||||||| ||||||| ||||||||||| |||| | ||| |||||||     
51752015 tccacaagtttacacctcataaccccttcagccctcagaatgtcttccgccttctcgaag-gtccttgtagtccaactacgctagaaatttcaggtagtt 51751917  T
140 ccacaagcattcaccataacatcttcaa 167  Q
    | |||||  |  |||||||| |||||||    
51751916 ctacaagactataccataacctcttcaa 51751889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 28221961 - 28221997
Alignment:
184 cttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    |||||||||||||||||||||||||||||||||||||    
28221961 cttccttgaagatcaccttgcatccaatcacccttgg 28221997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 167
Target Start/End: Complemental strand, 16228128 - 16228022
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
16228128 aacctcttcagccatcggaatttcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataac 16228030  T
160 atcttcaa 167  Q
     |||||||    
16228029 ctcttcaa 16228022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 165
Target Start/End: Original strand, 31928726 - 31928788
Alignment:
102 tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttc 165  Q
    |||||||| |||||||||||||||| ||||||||||| |||||||| | ||||||||| |||||    
31928726 tccttgca-tccaactacactaggatttttaggtagttccacaagcctacaccataacctcttc 31928788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 138
Target Start/End: Complemental strand, 47179315 - 47179243
Alignment:
65 cttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagt 138  Q
    ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| |||||||    
47179315 cttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagt 47179243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8954040 - 8953993
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagta 49  Q
    |||||||||| |||||||||||||||| |||||| ||||||||||||||    
8954040 atctacttgtgcccaatcacccttggc-ttttagggtaatccacaagta 8953993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 50167881 - 50167924
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||||    
50167881 tctcccgcttccttgaatatcaccttgcatccaataacccttgg 50167924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 197
Target Start/End: Complemental strand, 16430640 - 16430486
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    |||||||||| ||||||  ||||| ||||| ||| | |||| ||||||||||||||||||| |||||| |  | || |||||||||| ||| |||||||     
16430640 tccacaagtacacacct--taacctcttcagccatcagaatgtcttccgccttctcgaaga-tccttgtatccaaattacactaggaatttcaggtagtt 16430544  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatc 197  Q
    | |||||  |  |||||||| |||| ||  |  |||||||||  ||||||||||||||    
16430543 ctacaagactataccataacctctttaatacggaacatctccctcttccttgaagatc 16430486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 165
Target Start/End: Complemental strand, 19753677 - 19753623
Alignment:
111 tccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttc 165  Q
    |||||||||||||||| |||||||||||  ||||||| | ||||||||| |||||    
19753677 tccaactacactaggatttttaggtagttacacaagcctacaccataacctcttc 19753623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 221
Target Start/End: Complemental strand, 8954083 - 8954014
Alignment:
152 accataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    |||||||| |||||||  || ||||||||| |||||||||||||||  ||||   |||||||||||||||    
8954083 accataacctcttcaatacagaacatctcccgcttccttgaagatctacttgtgcccaatcacccttggc 8954014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 47)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 6064249 - 6064484
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| |||||  || |||||| |||||||||||||||||||    
6064249 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagtcatcggaatgtcttccgccttctcgaaga 6064345  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||    
6064346 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacgcagaacatctcctgcttccttgaagatcacc 6064445  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
6064446 ttgcatccaatcacccttggcattcttttagagtaatct 6064484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 457708 - 457474
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  || ||||||| ||| |||||||||||||||||||||||||     
457708 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaacacttcagccatcggaatatcttccgccttctcgaag- 457613  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||| |||||||||||||||||    
457612 gtccttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacacagaacatctcctacttccttgaagatcacc 457513  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
457512 ttgcatccaatcacccttggcattcttttagagtaatct 457474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 10956805 - 10957038
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  |||| ||||| ||| |||||||||||||||||||||||||     
10956805 atctacttgtacccaatcacccttgg-tttttagagtaatccacaagtatacacctc--aaccccttcagccatcggaatatcttccgccttctcgaag- 10956900  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||    
10956901 gtccttgcagtctaactacactaggagttttaggtagtcccacaagcattcaccacaacatcttcaacgcagaacatctcccgcttccttgaagatcacc 10957000  T
201 ttgcatccaatcacccttggcattcttttagaataatc 238  Q
    ||||||||||||||||||||| |||||||||| |||||    
10957001 ttgcatccaatcacccttggccttcttttagagtaatc 10957038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 11169903 - 11169669
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||  |||| ||| | ||| |||||| ||||||||||||||||||     
11169903 atctacttgtagccaatcacccttggctttt-agagtaatccacaagtatacacttc--aacccctttagccatcggaatgtcttccgccttctcgaag- 11169808  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||    
11169807 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacacaaaacatctcccgcttccttgaagatcacc 11169708  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
11169707 ttgcatccaatcacccttggcattcttttagagtaatct 11169669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 5899216 - 5898980
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccac-ttcacccaccggaatatcttccgccttctcgaag 99  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||  ||||| | |||| ||  |||||||||||||||||||||||||    
5899216 atctacttgttcccaatcacccttggctttt-agagtaatccacaagtatacacct--taacccccttcagccctcggaatatcttccgccttctcgaag 5899120  T
100 agtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaag-atca 198  Q
     ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||  |||||| |||| ||||||||| ||||    
5899119 -gtccttgcagtccaactacgctaggaattttaggtagtcccacaagcattcaccataacatcttcagcgcaggacatcttctgcctccttgaagaatca 5899021  T
199 ccttgcatccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||||||||||||||||||||||||||| |||||||    
5899020 ccttgcatccaatcacccttggcattcttttaggataatct 5898980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 82 - 231
Target Start/End: Complemental strand, 43227805 - 43227656
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
43227805 tcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcc 43227706  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
     ||||||||||||||||||||||||||||||||||||||| |||||||||    
43227705 cgcttccttgaagatcaccttgcatccaatcacccttggccttcttttag 43227656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 43422209 - 43422435
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||| |   | |||| |||||||||||||||||      
43422209 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcagctctcagaatgtcttccgccttctcgaat- 43422304  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||| |||| | ||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| ||||||||||||||||||    
43422305 gtccttgcagtccaactacgctagaaattttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccgcttccttgaagatcacc 43422404  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    | |||||||||||||||||||||| ||||||    
43422405 tagcatccaatcacccttggcatttttttag 43422435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 59 - 238
Target Start/End: Complemental strand, 42991746 - 42991567
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||    
42991746 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtactcccacaagcatttaccataa 42991647  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
    |||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||| || ||||||| |||||    
42991646 catcttcaacgcatgacatctcccgcttccttgaagatcaccttgtatccaatcacccttggcctttttttagagtaatc 42991567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 4309022 - 4309184
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4309022 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 4309121  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||||| ||| ||||||||| ||||||||||| |||||||||||||||||||||||||||    
4309122 catcttcaatgcagaacatctcccgcttccttgaatatcaccttgcatccaatcacccttggc 4309184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 53916412 - 53916645
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||| ||  | |||| ||||||||||||||||||     
53916412 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcagccctcagaatgtcttccgccttctcgaag- 53916507  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||| |||||| |||||  ||||||||||| ||||||||||| |||||||| |||||||| ||  |||||||| |||||||||||||| |||    
53916508 gtccttgcagtctaactacgctaggtattttaggtagttccacaagcattaaccataacctcttcaacacaggacatctcccgcttccttgaagattacc 53916607  T
201 ttgcatccaatcacccttggcattcttttagaataatc 238  Q
    ||||||||||||||| ||||| || |||||| ||||||    
53916608 ttgcatccaatcaccgttggcctttttttaggataatc 53916645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 82 - 238
Target Start/End: Original strand, 35918713 - 35918869
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||  ||||||||    
35918713 tcttccgtcttctcgaagagtccttgcagtccaactacactagaagttttaggtagtcccacacgcattcaccataacatcttcaatgcaggacatctcc 35918812  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
      |||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
35918813 cacttccttgaagatcaccttgcatccaatcacccttggccttcttttagagtaatc 35918869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 18097624 - 18097796
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
18097624 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttatgtagttccacaagcattcaccataa 18097723  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
     ||||||||| ||  |||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||    
18097724 tatcttcaacacaggacatctcccgctcccttgaagatcgccttgcatccaatcacccttggccttcttttag 18097796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 890643 - 890870
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccac-ttcacccaccggaatatcttccgccttctcgaag 99  Q
    ||||||||||  |||||||||||||| |||| ||||||||||||||||| ||||||  ||||| | |||| ||| |||||| ||||||||||||||||||    
890643 atctacttgtggccaatcacccttggatttt-agagtaatccacaagtaaacacct--taacccccttcagccatcggaatgtcttccgccttctcgaag 890739  T
100 agtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcac 199  Q
    | |||||||||||  ||||| |||||| ||||||||||| ||||||||||||||||||||||||| ||| ||  | |||||| | || ||||||| ||      
890740 a-tccttgcagtcagactacgctaggaattttaggtagttccacaagcattcaccataacatctttaacacaggatatctcccgttttcttgaaggtctt 890838  T
200 cttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||||| |||||| || ||||||    
890839 cttgcatccaatcactcttggcctttttttag 890870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 28138033 - 28138205
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| ||||||||||| ||||||||||||||||||| |||| ||||||||||||  ||||||||||||||||||    
28138033 taacctcttcagccatcggaacgtcttccgtcttctcgaagaatccttgcagtccaactacattaggtgttttaggtagtttcacaagcattcaccataa 28138132  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    | |||||||| ||| |||||| | |||||||||||  || |||||| |||||||||||||||| || ||||||    
28138133 cctcttcaacacatgacatcttccgcttccttgaaagtctccttgcttccaatcacccttggcctttttttag 28138205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 40 - 168
Target Start/End: Original strand, 35918575 - 35918702
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| |||||  |||| ||  |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
35918575 tccacaagtttacacctcttaacccattcagccctcggaatgtcttccgccttctcgaa-agtccttgcagtccaactacactaggagttttaggtagtc 35918673  T
140 ccacaagcattcaccataacatcttcaac 168  Q
    ||||||||||||||| |||| ||||||||    
35918674 ccacaagcattcaccttaacctcttcaac 35918702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 75 - 219
Target Start/End: Complemental strand, 3316131 - 3315988
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| ||||||||||||||||||| ||| || ||||||||||| |||||||||||||||||||||||||||||  |  |    
3316131 cggaatgtcttccgccttctcgaag-gtccttgcagtccaactacgctaagaattttaggtagttccacaagcattcaccataacatcttcaacatagga 3316033  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
    |||||||  ||||||||||| ||  ||||||| ||||||||||||    
3316032 catctcccacttccttgaaggtcttcttgcattcaatcacccttg 3315988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 84 - 231
Target Start/End: Original strand, 28100825 - 28100972
Alignment:
84 ttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctg 183  Q
    ||||| ||||||||||||||||| ||||||||| |||||||| |||||||||||| |||||||||||||||||||| ||||||||  |  |||||| |      
28100825 ttccgtcttctcgaagagtccttacagtccaacgacactaggtgttttaggtagttccacaagcattcaccataacctcttcaacataggacatcttcca 28100924  T
184 cttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||  || ||||||||||||||||||||||| || ||||||    
28100925 cttccttgaaagtctccttgcatccaatcacccttggcctttttttag 28100972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 4308907 - 4309032
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  | |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||    
4308907 tccacaagtttacacctcataaccccttcagccctcagaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggagttttaggtaatc 4309005  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
4309006 ccacaagcattcaccttaacctcttca 4309032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 40 - 164
Target Start/End: Complemental strand, 43227943 - 43227820
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| | ||| ||||| ||  |||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||     
43227943 tccacaagtttacacctcatgaccccttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttagttagtt 43227845  T
140 ccacaagcattcaccataacatctt 164  Q
    ||||||||||||||| |||| ||||    
43227844 ccacaagcattcaccttaacctctt 43227820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 28100687 - 28100810
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||  ||||| ||||| ||| |||||| |||||||||||||||||| |||||||||||||| |||||||| || |||||||||||     
28100687 tccacaagtttacacct--taaccccttcagccatcggaatgtcttccgccttctcgaag-gtccttgcagtccatctacactatgaattttaggtagtt 28100783  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
28100784 ccacaagcattcaccttaacctcttca 28100810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 42991861 - 42991736
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  || ||| |||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||     
42991861 tccacaagtttacacctcttaaccccttcagccctcgaaatgtcttccgccttctcgaag-gtccttgtagtccaactacactaggaattttaggtagtt 42991763  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||| ||||||||| |||| ||||||    
42991762 ccacatgcattcaccttaacctcttca 42991736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 18097511 - 18097634
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| ||||||||   ||| ||||| ||| |||||| |||||| ||||||||||| ||||||||||||||||||  |||||| |||||||||||     
18097511 tccacaagtttacacctcc--accccttcagccatcggaatgtcttccaccttctcgaag-gtccttgcagtccaactaggctaggaattttaggtagtt 18097607  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
18097608 ccacaagcattcaccttaacctcttca 18097634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 28137920 - 28138043
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||  ||| | ||||| ||| |||||| |||||| ||||||| ||| |||||||||||||||||||||||| | |||||||||||     
28137920 tccacaagtttacacct--taatcccttcagccatcggaatgtcttcctccttctcaaag-gtccttgcagtccaactacactagaaattttaggtagtt 28138016  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
28138017 ccacaagcattcaccttaacctcttca 28138043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 6064114 - 6064275
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||||||||||||||||||||||| | |||| |||||||||||||||||| ||| ||||||| | |||||  |  ||||||||    
6064114 aacctcttcagccatcggaatatcttccgccttctcgaaga-tgcttgtagtccaactacactaggaatttcaggtagttctacaagactataccataac 6064212  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   ||||||||||| |||||||||||||  |||| | |||||||||||||||    
6064213 ctcttcaatacgagacatctcctgctttccttgaagatctacttgtacccaatcacccttggc 6064275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 75 - 221
Target Start/End: Original strand, 53916294 - 53916438
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| ||||||||||||||||||| |||||  ||||||||||| |||||| ||| ||||||| | |||||  |  |||||| | |||||||| ||  |    
53916294 cggaatgtcttccgccttctcgaaga-tccttatagtccaactacgctaggaatttcaggtagttctacaagactataccata-cttcttcaacacagga 53916391  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    |||||||||||||||||||||||  ||||   |||||||||||||||    
53916392 catctcctgcttccttgaagatctacttgtgcccaatcacccttggc 53916438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3306277 - 3306223
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacct 56  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
3306277 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct 3306223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 3306396 - 3306251
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||  |   |    
3306396 cggaatgtcttccgccttctcgaaga-tgcttgtagtccaactactctaggaatttcaggtagttctacaagactataccataacctcttcaatacgaga 3306298  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||| |||||||||||||||  ||||   |||||||||||||||    
3306297 catctcccgcttccttgaagatctacttgtgcccaatcacccttggc 3306251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 43422076 - 43422235
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||| ||||||||||||||||||| ||||||  ||||||||||||||||| ||| ||||||| | |||||  |  ||||||     
43422076 taacctcttcagccatcagaatgtcttccgccttctcgaaga-tccttgt-gtccaactacactaggaatttcaggtagttctacaagactgtaccata- 43422172  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||| ||| || | |||||||||||||||||||  ||||   |||||||||||||||    
43422173 cttcttcaacacatgacttgtcctgcttccttgaagatctacttgtgcccaatcacccttggc 43422235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 59 - 168
Target Start/End: Complemental strand, 23636526 - 23636418
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| |||||| |    |||||| |||||| ||| ||||||| |||| ||||||||||||||    
23636526 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tccttgtatcgaaactacgctaggaatttcaggtagttccactagcattcaccataa 23636428  T
159 catcttcaac 168  Q
    | ||||||||    
23636427 cctcttcaac 23636418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 40 - 167
Target Start/End: Original strand, 7607052 - 7607178
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| || ||||| ||||| ||||| ||| | |||| ||||||||||||||||||| |||||| ||||||||||| | |||| ||| |||||||     
7607052 tccacaagtttatacctcttaacctcttcagccatcagaatgtcttccgccttctcgaaga-tccttgtagtccaactacgccaggaatttcaggtagtt 7607150  T
140 ccacaagcattcaccataacatcttcaa 167  Q
    | |||||  |  |||||||| |||||||    
7607151 ctacaagactataccataacctcttcaa 7607178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 40 - 221
Target Start/End: Complemental strand, 11170056 - 11169877
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| ||||||||  |||| ||||| ||| |||||| ||||||||||||  ||||| | |||| ||||||||||| |||||| ||| |||||||     
11170056 tccacaagtttacacctc--aacctcttcagccatcggaatgtcttccgccttcatgaaga-tgcttgtagtccaactacgctaggaatttcaggtagtt 11169960  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgctt-ccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||  |  |||||||| |||||||  |   |||||||| |||| |||||||||||  |||| | |||||||||||||||    
11169959 ctacaagactataccataacctcttcaataccagacatctcccgctttccttgaagatctacttgtagccaatcacccttggc 11169877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 457828 - 457682
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||  |   |    
457828 cggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataacctcttcaatacgaga 457730  T
175 catctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||| || |||||||||||||  |||| | |||||||||||||||    
457729 tatctcccgctttccttgaagatctacttgtacccaatcacccttggc 457682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 15824389 - 15824432
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||    
15824389 tctcccgcttccttgaatatcaccttgcatccaatcacccttgg 15824432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 29812510 - 29812463
Alignment:
173 aacatctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||||||| |||||||||||||||||||||||||| ||||| |||||    
29812510 aacatctcccgcttccttgaagatcaccttgcatccgatcacgcttgg 29812463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 37407896 - 37407853
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| |||||||||||||||||||||||||| |||||||||||    
37407896 tctcccgcttccttgaagatcaccttgcatccgatcacccttgg 37407853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 165
Target Start/End: Original strand, 43402878 - 43402940
Alignment:
102 tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttc 165  Q
    |||||||| |||||||||||||||| ||||||||||| |||||||| | ||||||||| |||||    
43402878 tccttgca-tccaactacactaggatttttaggtagttccacaagcctacaccataacctcttc 43402940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 220
Target Start/End: Original strand, 10956686 - 10956830
Alignment:
76 ggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataac 175  Q
    ||||| ||||||||||||||||||| | |||| ||||||||||| ||| || ||| ||||||| | |||||  |  |||||||| |||||||  |   ||    
10956686 ggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctacgaatttcaggtagttctacaagactataccataacctcttcaatacgagac 10956784  T
176 atctcctgc-ttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    |||||| || |||||||||||||  |||| | ||||||||||||||    
10956785 atctcccgctttccttgaagatctacttgtacccaatcacccttgg 10956830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10210837 - 10210793
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || ||||||||||||||||||||||| ||||||||||||    
10210837 tctcccgcctccttgaagatcaccttgcatccgatcacccttggc 10210793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 5258853 - 5258896
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||| |||||||||||||||||| |||||||||||    
5258853 tctcccgcttcctcgaagatcaccttgcatccgatcacccttgg 5258896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 221
Target Start/End: Original strand, 4599219 - 4599292
Alignment:
149 ttcaccataacatcttcaacg-cataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||| | ||||||||||  || ||| ||||| || |||| |||||||||||||||||| ||||||||||||    
4599219 ttcaccaaaccatcttcaaccacagaacgtctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 4599292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 23635099 - 23635058
Alignment:
190 tgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||||||||| ||||||||||||||||| || ||||||    
23635099 tgaagatcaccttgtatccaatcacccttggcctttttttag 23635058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 7763892 - 7763856
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatca 213  Q
    ||||| ||||||| |||||||||||||||||||||||    
7763892 tctcccgcttcctcgaagatcaccttgcatccaatca 7763856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10057884 - 10057840
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
10057884 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 10057840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10060106 - 10060062
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
10060106 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 10060062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10062328 - 10062284
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
10062328 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 10062284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10064550 - 10064506
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
10064550 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 10064506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 10066772 - 10066728
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
10066772 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 10066728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 32)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 31156744 - 31156976
Alignment:
4 tacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtc 103  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||| |||||||||||||||  ||||||||||||    
31156744 tacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccatcggaatatcttccgcactctcgaagagtc 31156840  T
104 cttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttg 203  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
31156841 cttgcagtccaactacactaggagttttaggtagtcccacaagctttcaccataacatcttcaacgcagaacatctcctgcttccttgaagatcaccttg 31156940  T
204 catccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||||||||||||||||||||||| ||||||    
31156941 catccaatcacccttggcattcttttagagtaatct 31156976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 1047745 - 1047979
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
1047745 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 1047840  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
1047841 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcccgcttccttgaagatcacc 1047940  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
1047941 ttgcatccaatcacccttggcattcttttagagtaatct 1047979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 44071 - 43845
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
44071 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 43976  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
43975 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcccgcttccttgaagatcacc 43876  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||||||||||| |||||||||    
43875 ttgcatccaatcacccttggccttcttttag 43845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 22136635 - 22136401
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||||||||||||||||||||||     
22136635 atctacttatacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatatcttccgccttctcgaag- 22136540  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| | ||||||||||||||||||    
22136539 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcaacgcagaacatcttccgcttccttgaagatcacc 22136440  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
22136439 ttgcatccaatcacccttggcattcttttagagtaatct 22136401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40551662 - 40551428
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||||||||||||||||||||||     
40551662 atctacttatacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatatcttccgccttctcgaag- 40551567  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| | ||||||||||||||||||    
40551566 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcaacgcagaacatcttccgcttccttgaagatcacc 40551467  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
40551466 ttgcatccaatcacccttggcattcttttagagtaatct 40551428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7350109 - 7350343
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||  || | ||||| ||   ||||| ||||||||||||||||||     
7350109 atctacttgtacccaatcacccttgactttt-agagtaatccacaagtatacacctc--aatcccttcagcccttggaatgtcttccgccttctcgaag- 7350204  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||    
7350205 gtccttgcagtccaactacactagaagttttaggtagtcccacaagctttcaccataacatcttcaacacagaacatctcctgcttccttgaagatcacc 7350304  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||| ||||| ||||||||||| ||||||    
7350305 ttgcatccaatcactcttggtattcttttagagtaatct 7350343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 59 - 231
Target Start/End: Complemental strand, 20298757 - 20298585
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20298757 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 20298658  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||    
20298657 catcttcaacgcagaacatctcccgcttccttgaagatcaccttgcatccaatcactcttggccttcttttag 20298585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 59 - 239
Target Start/End: Complemental strand, 28487042 - 28486862
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||    
28487042 taacctcttcagccatcggaacgtcttccgtcttctctaagagtccttgcggtccaactacaccaggagttttaggtagtcccacaagcattcaccaaaa 28486943  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||    
28486942 catcttcaacgcagaacatctcccgcttccttgaagatcaccttgcatccaatcacccttggccttcttttagagtaatct 28486862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 59 - 238
Target Start/End: Original strand, 7092971 - 7093150
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
7092971 taacctcttcagccatcggaacgtcttcggtcttctcgaagagtccttgcagtccaactacactaggatttttaggtagtcccacaagcattcaccataa 7093070  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
    |||||||||||||  ||||||||  ||||||||||| |||||||||||||||||||||||||| | |||||||| |||||    
7093071 catcttcaacgcaggacatctcccacttccttgaaggtcaccttgcatccaatcacccttggcctccttttagagtaatc 7093150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 9680206 - 9679980
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||  ||  || ||| |||||| |||||||||||     
9680206 atctacttgtgcccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcggccctcgtaatgtcttccaccttctcgaag- 9680111  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||  ||||| |||| | ||||||||||| |||||||||||||||||||||| |||||| ||| |||||||| |||||||||||| || ||    
9680110 gtccttgcagtcagactacgctagaaattttaggtagttccacaagcattcaccataacatgttcaacacatgacatctcccgcttccttgaaggtctcc 9680011  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
     |||||||||||||||||||| || ||||||    
9680010 atgcatccaatcacccttggcctttttttag 9679980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 86 - 231
Target Start/End: Complemental strand, 21679528 - 21679383
Alignment:
86 ccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgct 185  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| | ||||||||||||||||||||||||||| || ||||||| | |||    
21679528 ccgccttctcgaagagtccttgcagtccaactacactaggaattttatgtagttcgacaagcattcaccataacatcttcaacacagaacatcttccgct 21679429  T
186 tccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||| |||||||||||||||||||||||||| || ||||||    
21679428 tccttgaaggtcaccttgcatccaatcacccttggcctttttttag 21679383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 7470827 - 7470999
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||| | ||||||  |||||| |||||||||||||||||||||||||||||||    
7470827 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcacttcaactatgctaggaattttaggtagtcccacaagcattcaccataa 7470926  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    |||||||||| ||  |||||||||||| ||||||||||||| ||||||||||||||||||||  |||||||||    
7470927 catcttcaacacaggacatctcctgctcccttgaagatcactttgcatccaatcacccttggacttcttttag 7470999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 75 - 219
Target Start/End: Complemental strand, 44726399 - 44726256
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |    
44726399 cggaatgtcttccgccttctcgaag-gtcattgcagtccaactacactaggaattttaggtagttccacaagcattcaccataacatcttcaacacagga 44726301  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
    ||||||| |||||||||||| || |||||||||||||||||||||    
44726300 catctcccgcttccttgaaggtctccttgcatccaatcacccttg 44726256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 90 - 231
Target Start/End: Complemental strand, 38395747 - 38395609
Alignment:
90 cttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttcct 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||| ||| |||||||| |||||||    
38395747 cttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcacc---acatcttcaacacatgacatctcccgcttcct 38395651  T
190 tgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||| || |||||||||||||||  |||||| || ||||||    
38395650 tgaaggtctccttgcatccaatcatgcttggcctttttttag 38395609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 42 - 166
Target Start/End: Complemental strand, 38395891 - 38395768
Alignment:
42 cacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtccc 141  Q
    ||||||| |||||||| |||||  |||| ||  |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
38395891 cacaagtttacacctcataaccctttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggagttttaggtagtccc 38395793  T
142 acaagcattcaccataacatcttca 166  Q
    ||||||||||||| |||| ||||||    
38395792 acaagcattcaccttaacctcttca 38395768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 59 - 166
Target Start/End: Complemental strand, 20298854 - 20298747
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
20298854 taacctcttcagccatcggaacgtcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccttaa 20298755  T
159 catcttca 166  Q
    | ||||||    
20298754 cctcttca 20298747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 7470712 - 7470837
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| || || ||||| ||  |||||| |||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||     
7470712 tccacaagtttacacctcatagccccttcagccctcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacattaggaattttaggtagta 7470810  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
7470811 ccacaagcattcaccttaacctcttca 7470837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 28487157 - 28487032
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| ||||||||  |||| ||||| ||| |||||||| |||||||||||||||| ||||||| ||||||||||| |||||| |||||||||||     
28487157 tccacaagtttacacctctaaaccccttcagccatcggaatattttccgccttctcgaag-gtccttgtagtccaactacgctaggaattttaggtagtt 28487059  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
28487058 ccacaagcattcaccttaacctcttca 28487032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 75 - 166
Target Start/End: Complemental strand, 20298934 - 20298844
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttca 166  Q
    |||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||| ||||||    
20298934 cggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccttaacctcttca 20298844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 7092856 - 7092981
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| |   | |||| |||||||||||||||||| ||||||| ||||||||||| |||||| |||||||||||     
7092856 tccacaagtttacacctcataaccccttcagctctcagaatgtcttccgccttctcgaag-gtccttgtagtccaactacgctaggaattttaggtagtt 7092954  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
7092955 ccacaagcattcaccttaacctcttca 7092981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 59 - 165
Target Start/End: Complemental strand, 21679651 - 21679546
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||| | |||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| ||||||||||||||| |||    
21679651 taaccccttcagccatcggattgtcttccgccttctcgaag-gtccttgcagtccaactacgctaggaattttaggtagttccacaagcattcaccttaa 21679553  T
159 catcttc 165  Q
    | |||||    
21679552 cctcttc 21679546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 221
Target Start/End: Original strand, 24815808 - 24815985
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    |||||||||| ||||||  ||||| ||||| ||| |||||| | |||||||||||||||| |||||||||  ||||||||||||||| |||||||||||     
24815808 tccacaagtacacacct--taacctcttcagccatcggaatgtattccgccttctcgaag-gtccttgcac-ccaactacactaggaattttaggtagtt 24815903  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | ||||| |||||| ||||| |||||||| |   | | |||| |||||| |||||||| |||| |||||||||| |||||||    
24815904 ctacaagtattcacaataacgtcttcaacacgggataactcccgcttccatgaagatctcctttcatccaatcaaccttggc 24815985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 60 - 219
Target Start/End: Original strand, 7349974 - 7350133
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||||||||||| | |||||  |  ||||||||    
7349974 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaattttaggtagttctacaagactataccataac 7350072  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttg 219  Q
     |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||    
7350073 ctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttg 7350133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 1047609 - 1047771
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||    
1047609 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataa 1047707  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
1047708 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 1047771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 167
Target Start/End: Complemental strand, 22136770 - 22136664
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
22136770 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataac 22136672  T
160 atcttcaa 167  Q
     |||||||    
22136671 ctcttcaa 22136664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 167
Target Start/End: Complemental strand, 40551797 - 40551691
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
40551797 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataac 40551699  T
160 atcttcaa 167  Q
     |||||||    
40551698 ctcttcaa 40551691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 48491042 - 48490999
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||    
48491042 tctcccgcttctttgaagatcaccttgcatccaatcacccttgg 48490999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 165
Target Start/End: Original strand, 4509673 - 4509753
Alignment:
83 cttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttc 165  Q
    |||||||||||| ||||  |||||||| |||||||||||||||| |||||| |||| |||||||| | ||||||||| |||||    
4509673 cttccgccttcttgaagt-tccttgca-tccaactacactaggatttttagatagttccacaagcctacaccataacctcttc 4509753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 165
Target Start/End: Original strand, 4511515 - 4511595
Alignment:
83 cttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttc 165  Q
    |||||||||||| ||||  |||||||| |||||||||||||||| |||||| |||| |||||||| | ||||||||| |||||    
4511515 cttccgccttcttgaagt-tccttgca-tccaactacactaggatttttagatagttccacaagcctacaccataacctcttc 4511595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 47674669 - 47674711
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
    ||||| |||||||||||||||||||||||||| ||||||||||    
47674669 tctcccgcttccttgaagatcaccttgcatccgatcacccttg 47674711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 167
Target Start/End: Original strand, 31156621 - 31156712
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaa 167  Q
    |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||    
31156621 cggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataacctcttcaa 31156712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 6593062 - 6593106
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
6593062 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 6593106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 33310711 - 33310477
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||||||||||||||||||||||     
33310711 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatatcttccgccttctcgaag- 33310616  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
33310615 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccatcttcaacgcagaacatctcctgcttccttgaagatcacc 33310516  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
33310515 ttgcatccaatcacccttggcattcttttagagtaatct 33310477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 26066854 - 26067087
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||| |||||| ||||||| ||||||||||     
26066854 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccatcggaatgtcttccgtcttctcgaag- 26066949  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||    
26066950 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcaacgcagaacatctcctgcttccttgaagatcacc 26067049  T
201 ttgcatccaatcacccttggcattcttttagaataatc 238  Q
    |||||||||||||| ||||||||||||||||| |||||    
26067050 ttgcatccaatcactcttggcattcttttagagtaatc 26067087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 3630662 - 3630878
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||||||||||||||| |||||||||||||| |||||||||  ||||| ||||| ||  || ||| ||||||||||||||||||     
3630662 atctacttgtgcccaatcacccttggctttt-agagtaatccacaactatacacct--taaccccttcagccctcgaaatgtcttccgccttctcgaag- 3630757  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |||| ||| |||||||||||| || ||    
3630758 gtccttgcagtccaactacgctaggaattttaggtagttccacaagcattcaccataacatcttcaacacaggacatatcccgcttccttgaaggtctcc 3630857  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||||||||||    
3630858 ttgcatccaatcacccttggc 3630878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 3395853 - 3395639
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||  |||||||||||||||||||||| ||||||||||||||||||||||||  ||||| ||||| ||  |||||| ||||||||||||||||||     
3395853 atctactaatacccaatcacccttggctttt-agagtaatccacaagtatacacct--taaccccttcagccctcggaatgtcttccgccttctcgaag- 3395758  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||| ||||| ||||||||||| |||||| |||||||||||||||||||||| ||  |||||||| |||||||||||| ||  |    
3395757 gtccttgcagtccaactacaataggaattttaggtagttccacaaacattcaccataacatcttcaacacaggacatctcccgcttccttgaaggtcttc 3395658  T
201 ttgcatccaatcacccttg 219  Q
    |||||||||||||||||||    
3395657 ttgcatccaatcacccttg 3395639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 82 - 231
Target Start/End: Original strand, 15533450 - 15533600
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||  ||||||||    
15533450 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagttccacaagcattcaccatgacatcttcaacacaagacatctcc 15533549  T
182 tgcttccttgaagatcaccttgcatcc-aatcacccttggcattcttttag 231  Q
     |||||||||||| || |||||||||| ||||||||||||| || ||||||    
15533550 cgcttccttgaaggtctccttgcatccaaatcacccttggcctttttttag 15533600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 59 - 219
Target Start/End: Original strand, 30729457 - 30729616
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||  ||||||||||||||||||    
30729457 taaccccttcagccatcggaatgtcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttacacaagcattcaccataa 30729555  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttg 219  Q
    |||||| ||| ||  || ||||| |||||||||||||| ||||||||||||||||||||||    
30729556 catctttaacacaggacgtctcccgcttccttgaagattaccttgcatccaatcacccttg 30729616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 60 - 166
Target Start/End: Original strand, 15533332 - 15533437
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| | |||| |||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||| ||||| ||||||| | ||||    
15533332 aaccccttcagccatcagaatgtcttccgccttctcgaag-gtccttgcagtccaactacacttggaattttaggtagttccacaggcattcaacttaac 15533430  T
160 atcttca 166  Q
     ||||||    
15533431 ctcttca 15533437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 75 - 221
Target Start/End: Original strand, 3630543 - 3630688
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||| |||| |||||| ||| |||||||||||||| ||| ||||||| | |||||  |  | ||||||||||||||  | | |    
3630543 cggaatgtcttccgccttctcaaaga-tccttgtagttcaactacactaggaatttcaggtagttctacaagactataacataacatcttcaatacgtga 3630641  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||| |||||||||||||||  ||||   |||||||||||||||    
3630642 catctcccgcttccttgaagatctacttgtgcccaatcacccttggc 3630688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 83 - 168
Target Start/End: Complemental strand, 26944794 - 26944710
Alignment:
83 cttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaac 168  Q
    |||||||||| |||||| ||||||||||||||||||  |||||| ||||||||||| ||||||| || ||||||||| ||||||||    
26944794 cttccgccttttcgaag-gtccttgcagtccaactatgctaggaattttaggtagttccacaagtatccaccataacctcttcaac 26944710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 60 - 221
Target Start/End: Complemental strand, 33310846 - 33310685
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
33310846 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataac 33310748  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
33310747 ctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 33310685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 26066719 - 26066880
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| |||||| |||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  ||||||||    
26066719 aacctcttcagccatcggaatgtcttcctccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataac 26066817  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||| ||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
26066818 ctctttaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 26066880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 167
Target Start/End: Complemental strand, 3395989 - 3395882
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||| ||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||    
3395989 taacctcttcagccatcggaatgtcttctgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataa 3395891  T
159 catcttcaa 167  Q
    | |||||||    
3395890 cctcttcaa 3395882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 168
Target Start/End: Complemental strand, 11137892 - 11137783
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagag--tccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccata 157  Q
    |||| ||||| ||| ||||||  |||||||||||  |||||   |||||||| |||||||||||||||| ||||||||||| |||||||  | |||||||    
11137892 aacctcttcaaccatcggaatgccttccgccttcatgaagaccatccttgca-tccaactacactaggaattttaggtagttccacaagtctacaccata 11137794  T
158 acatcttcaac 168  Q
    ||  |||||||    
11137793 accacttcaac 11137783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 34166523 - 34166479
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||| |||||||||||||||||| ||||||||||||    
34166523 tctcccgcctcctcgaagatcaccttgcatccgatcacccttggc 34166479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 35216426 - 35216660
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
35216426 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 35216521  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||    
35216522 gtccttgcagtccaactacactaggagtttcaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcctgcttcattgaagatcacc 35216621  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||||||||||    
35216622 ttgcatccaatcacccttggcattcttttagaataatct 35216660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 19502792 - 19503026
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||| ||||     
19502792 atctacttatacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttcttgaag- 19502887  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |    
19502888 gttcttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcagaacatctcctgcttccttgaagatcatc 19502987  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
19502988 ttgcatccaatcacccttggcattcttttagagtaatct 19503026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36559601 - 36559835
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||  |||||||||||||||||||||||||  |||| ||||| ||  |||||||||||||||||||||||||     
36559601 atctacttgtacccaatcacccttggctttc-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatatcttccgccttctcgaag- 36559696  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| | ||||||||||||||||||    
36559697 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcaacgcagaacatcttccgcttccttgaagatcacc 36559796  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
36559797 ttgcatccaatcacccttggcattcttttagagtaatct 36559835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 90 - 230
Target Start/End: Original strand, 21519181 - 21519321
Alignment:
90 cttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttcct 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| |||||||    
21519181 cttctcgaagagtccttgcagtccaactacactaggagttttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccgcttcct 21519280  T
190 tgaagatcaccttgcatccaatcacccttggcattctttta 230  Q
    ||||| || ||||||||||||||||||||||| || |||||    
21519281 tgaaggtctccttgcatccaatcacccttggccttttttta 21519321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31733620 - 31733836
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||| |||| |||||||||||||||||||| || |||||||||||  |||||| || ||||  ||| | ||| |||||| |||||| ||||||| |||     
31733620 atctatttgtgcccaatcacccttggctttt-agggtaatccacaa--atacacatcttaacttctttagccatcggaatgtcttcctccttctcaaag- 31733715  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||| |||| | ||| ||||||| ||||||| || |||||||| ||||| ||| ||  |||||||| ||||||||||||||| ||    
31733716 gtccttgcagtccaactacgctagaaatttgaggtagttccacaagtatccaccataaaatctttaacacaggacatctcccgcttccttgaagatctcc 31733815  T
201 ttgcatccaatcacccttggc 221  Q
    ||||||||||||||| |||||    
31733816 ttgcatccaatcacctttggc 31733836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 6263002 - 6263119
Alignment:
114 aactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatca 213  Q
    |||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||  | |||||| |||||||||||||||||||||||||||||||    
6263002 aactacgctaggagttttaggtagttccacaagcattcaccataacatcttcaacacaggatatctcccgcttccttgaagatcaccttgcatccaatca 6263101  T
214 cccttggcattcttttag 231  Q
    | |||||| || ||||||    
6263102 cacttggcctttttttag 6263119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 59 - 164
Target Start/End: Original strand, 21519054 - 21519158
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||    
21519054 taaccccttcagccatcggaatatcttccgccttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccttaa 21519152  T
159 catctt 164  Q
    | ||||    
21519153 cctctt 21519158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 59 - 168
Target Start/End: Original strand, 22405147 - 22405255
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| ||||||  |||||||||||||||||| |||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||    
22405147 taacctcttcagccatcggaatggcttccgccttctcgaaga-tccttgaagtccaactacactaggaattttaggtagttccacaagcattcaccataa 22405245  T
159 catcttcaac 168  Q
    ||||||||||    
22405246 catcttcaac 22405255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 77 - 218
Target Start/End: Original strand, 13828965 - 13829105
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacg-cataac 175  Q
    |||| ||||||||||||| ||||| || ||||| |||||||||||||| | |||||| |||| ||||||| || ||||||||| ||||||||  |  |||    
13828965 gaatgtcttccgccttcttgaagattc-ttgca-tccaactacactagaaattttagttagttccacaagtatacaccataacctcttcaaccacggaac 13829062  T
176 atctcctgcttccttgaagatcaccttgcatccaatcaccctt 218  Q
    ||||||||||||||||||||||  |||| ||||||||||||||    
13829063 atctcctgcttccttgaagatcttcttgtatccaatcaccctt 13829105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 118
Target Start/End: Original strand, 6259708 - 6259808
Alignment:
14 caatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtcc 113  Q
    |||||||||||||||||| |||||||||||||||||  |||||  ||||| ||||| ||  ||||||||||||| ||||||||||| |||||||||||||    
6259708 caatcacccttggctttt-agagtaatccacaagtacgcacct--taaccccttcagccctcggaatatcttccaccttctcgaag-gtccttgcagtcc 6259803  T
114 aacta 118  Q
    |||||    
6259804 aacta 6259808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 221
Target Start/End: Original strand, 36559466 - 36559627
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataac 159  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| |||||||||||||||||| ||| ||||||| | |||||  |  ||||||||    
36559466 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacactaggaatttcaggtagttctacaagactataccataac 36559564  T
160 atcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||||  |   | |||||| || |||||||||||||  |||| | |||||||||||||||    
36559565 ctcttcaatacgagatatctcccgctttccttgaagatctacttgtacccaatcacccttggc 36559627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 14634529 - 14634572
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
14634529 tctcccgcttccttgaagatcaccttgcatccaatcacccttgg 14634572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 19502656 - 19502818
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||||||| ||||||  | |||||  |  |||||||    
19502656 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggagtttcaggtagctctacaagactataccataa 19502754  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||  | |||||||||||||||    
19502755 cctcttcaatacgagacatctcccgctttccttgaagatctacttatacccaatcacccttggc 19502818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 197
Target Start/End: Original strand, 31733468 - 31733622
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    |||||||||| ||||||  ||||| ||| | ||| |||||| ||||| |||||||||||||  ||||| |  | ||||||||||||| ||| |||||||     
31733468 tccacaagtacacacct--taacctctttagccatcggaatgtcttctgccttctcgaagaa-ccttgtatccaaactacactaggaatttcaggtagtt 31733564  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatc 197  Q
    | |||||  |  | |||||| |||||||  || ||||||||| |||||||||||||||    
31733565 ctacaagactatatcataacctcttcaatacagaacatctcccgcttccttgaagatc 31733622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 22405281 - 22405321
Alignment:
15 aatcacccttggctttttagagtaatccacaagtatacacct 56  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
22405281 aatcacccttggctttt-agagtaatccacaagtatacacct 22405321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 221
Target Start/End: Original strand, 35216308 - 35216452
Alignment:
77 gaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataaca 176  Q
    |||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||  |   | |    
35216308 gaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataacctcttcaatacgagata 35216406  T
177 tctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||| || |||||||||||||  |||| | |||||||||||||||    
35216407 tctcccgctttccttgaagatctacttgtacccaatcacccttggc 35216452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 194
Target Start/End: Original strand, 6259561 - 6259694
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| | |||| ||||||||||||||||||| |||||| |  | ||||||||||||| ||| ||||||| | |||||  |  ||||| |    
6259561 taacctcttcagccatcagaatgtcttccgccttctcgaaga-tccttgtatccaaactacactaggaatttcaggtagttctacaagactataccat-a 6259658  T
159 catcttcaacgcataacatctcctgcttccttgaag 194  Q
    | |||||||| ||  |||||||| ||||||||||||    
6259659 cttcttcaacacaggacatctcccgcttccttgaag 6259694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 15)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43081479 - 43081245
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||  |||||||||| ||| | |||||||||||||||||||||||     
43081479 atctacttgtacccaatcacccttggctttt-agagtaatcaacaagtatacacctc--aaccacttcagccatcagaatatcttccgccttctcgaag- 43081384  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||    
43081383 gtccttgcagtccaactacactaggagttttaggtagacccacaagctttcaccataacatcttcaacacagaacatctcctgcttccttgaagatcacc 43081284  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
43081283 ttgcatccaatcacccttggcattcttttagagtaatct 43081245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 27828849 - 27828629
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||| ||  |||||| ||||| ||||||||||||     
27828849 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctcataaccccttcagccctcggaatgtcttctgccttctcgaag- 27828752  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||                | ||||||||||||||||||    
27828751 gtccttgtagtccaactacactaggaattttaggtagtcccacaagcatttaccataacatctt----------------ccgcttccttgaagatcacc 27828668  T
201 ttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||||||||| ||||||    
27828667 ttgcatccaatcacccttggcattcttttagagtaatct 27828629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 82 - 231
Target Start/End: Complemental strand, 15072276 - 15072127
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||  ||||||||    
15072276 tcttccgtcttctcgaagagtccttgcagtccaactacactaggagttttaggtagttctacaagcattcaccataacatcttcaacacaggacatctcc 15072177  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||||||||| || ||||||||||||||||||||||| || ||||||    
15072176 tgcttccttgaaggtctccttgcatccaatcacccttggcctttttttag 15072127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41384248 - 41384022
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    |||||||||| |||||||| |||||| |||| |||||||||||||||||||||||||  |||| |||||  |  | |||| ||||||||||||||||||     
41384248 atctacttgtgcccaatcatccttggatttt-agagtaatccacaagtatacacctc--aaccccttcagtcctcagaatgtcttccgccttctcgaag- 41384153  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||| |||| |||||| |||||  ||||||||||| ||||||||||||||||||||||||||||| ||  |||||||| |||||||||||| |||||    
41384152 gtccttgaagtctaactacgctaggtattttaggtagttccacaagcattcaccataacatcttcaacacaggacatctcccgcttccttgaaggtcacc 41384053  T
201 ttgcatccaatcacccttggcattcttttag 231  Q
    ||||||| ||| ||||||||| || ||||||    
41384052 ttgcatcaaataacccttggcctttttttag 41384022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 59 - 166
Target Start/End: Complemental strand, 15072395 - 15072289
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||    
15072395 taaccccttcagccatcggaatatcttccgtcttctcgaag-gtccttgcagtccaactacactaggaattttaggtagttccacaagcattcaccttaa 15072297  T
159 catcttca 166  Q
    | ||||||    
15072296 cctcttca 15072289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 221
Target Start/End: Complemental strand, 27829004 - 27828823
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||| |||||| ||||||||||||||||||| |||||| ||||||||||| |||||| ||| |||||||     
27829004 tccacaagtttacacctcttaacctcttcagccatcggaatgtcttccgccttctcgaaga-tccttgtagtccaactacgctaggaatttcaggtagtt 27828906  T
140 ccacaagcattcaccataacatcttcaacgcataacatctcctgctt-ccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||  |  |||||||| |||||||  |  ||||||||| ||||  ||||||||||  |||| | |||||||||||||||    
27828905 ctacaagactataccataacctcttcaatacgaaacatctcccgcttaacttgaagatctacttgtacccaatcacccttggc 27828823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 221
Target Start/End: Complemental strand, 21481949 - 21481856
Alignment:
128 ttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||||||| || |||| || ||||||||| |||||||| ||  |||||||| ||||||||||||||| |||||||||||||||||||||||    
21481949 ttttaggtagttccgcaagtatccaccataacctcttcaacacaggacatctcccgcttccttgaagatctccttgcatccaatcacccttggc 21481856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 18812426 - 18812371
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctc 57  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
18812426 atctacttgtacccaatcacccttggc-ttttagagtaatccacaagtatacacctc 18812371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 65 - 220
Target Start/End: Complemental strand, 17849416 - 17849263
Alignment:
65 cttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatctt 164  Q
    ||||| ||| ||||||  |||||||||||| ||||| |||||||| |||||||||||||||| ||||||||||| |||||||  | ||||| | | ||||    
17849416 cttcaaccatcggaatgccttccgccttcttgaaga-tccttgca-tccaactacactaggaattttaggtagttccacaagtctacaccaaaccctctt 17849319  T
165 caacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||   |||  ||||   |||||||||||||||||||| ||||||||| ||||||    
17849318 caaccactaaagtctcacacttccttgaagatcaccttgtatccaatcatccttgg 17849263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 111 - 219
Target Start/End: Original strand, 31574411 - 31574521
Alignment:
111 tccaactacactaggagttttaggtagtcccacaagcattcaccataaca-tcttcaacgcata-acatctcctgcttccttgaagatcaccttgcatcc 208  Q
    |||||||||||||||| ||||||||||| || |||| || |||||||||  ||||||||    | || ||||||||||||||||||||| ||||||||||    
31574411 tccaactacactaggaattttaggtagttccgcaagtatacaccataaccctcttcaaccacgagacgtctcctgcttccttgaagatctccttgcatcc 31574510  T
209 aatcacccttg 219  Q
    |||||||||||    
31574511 aatcacccttg 31574521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 4733268 - 4733225
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| |||||||||||||||||||||||||| |||||||||||    
4733268 tctcccgcttccttgaagatcaccttgcatccgatcacccttgg 4733225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 41365542 - 41365589
Alignment:
173 aacatctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    |||||||||||||||||||||||||| | ||||||||||||| |||||    
41365542 aacatctcctgcttccttgaagatcatcgtgcatccaatcactcttgg 41365589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 43081599 - 43081453
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | |||||  |  |||||||| |||||||  |   |    
43081599 cggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagactataccataacctcttcaatacgaga 43081501  T
175 catctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
     |||||| || |||||||||||||  |||| | |||||||||||||||    
43081500 tatctcccgctttccttgaagatctacttgtacccaatcacccttggc 43081453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 34255036 - 34255079
Alignment:
177 tctcctgcttccttgaagatcaccttgcatccaatcacccttgg 220  Q
    ||||| ||||||| |||||||||||||||||| |||||||||||    
34255036 tctcccgcttcctcgaagatcaccttgcatccgatcacccttgg 34255079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 197
Target Start/End: Complemental strand, 41384383 - 41384246
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||| ||||||||||||||||||| |  ||| ||||||||||| |||| | ||| ||||||| | |||||  |  |||||||    
41384383 taacctcttcagccatcggaatgtcttccgccttctcgaaga-tgtttgtagtccaactacgctagaaatttcaggtagttctacaagactataccataa 41384285  T
159 catcttcaacgcataacatctcctgcttccttgaagatc 197  Q
    | |||||||  |   |||| ||| |||||||||||||||    
41384284 cctcttcaatacgagacatatcccgcttccttgaagatc 41384246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0140 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 23946 - 23730
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaaga 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| ||||| ||  |||||| ||||||||||||||||||     
23946 atctacttgtacccaatcacccttggctttt-agagtaatccacaagtatacacctc--aaccccttcagccctcggaatgtcttccgccttctcgaag- 23851  T
101 gtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcctgcttccttgaagatcacc 200  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| ||||||||| ||||||||||||||||||    
23850 gtccttgtagtccaactacactaggagttttaggtagtcccacaagcattcaccataccgtcttcagcgcagaacatctcccgcttccttgaagatcacc 23751  T
201 ttgcatccaatcacccttggc 221  Q
    |||||||||||||| ||||||    
23750 ttgcatccaatcactcttggc 23730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0140; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 221
Target Start/End: Complemental strand, 24082 - 23920
Alignment:
60 aaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaag-cattcaccataa 158  Q
    |||| ||||| ||| |||||| ||||||||||||||||||| | |||| ||||||||||| |||||| ||| ||||||| | ||||| | |  |||||||    
24082 aacctcttcagccatcggaatgtcttccgccttctcgaaga-tgcttgtagtccaactacgctaggaatttcaggtagttctacaagacttataccataa 23984  T
159 catcttcaacgcataacatctcctgc-ttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    | |||||||  |   |||||||| || |||||||||||||  |||| | |||||||||||||||    
23983 cctcttcaatacgagacatctcccgctttccttgaagatctacttgtacccaatcacccttggc 23920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1674 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: scaffold1674
Description:

Target: scaffold1674; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 59 - 239
Target Start/End: Original strand, 298 - 478
Alignment:
59 taaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataa 158  Q
    ||||| ||||| ||| |||||  ||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||  |||||||||||||    
298 taacctcttcagccatcggaacgtcttccgacttctcgaagagtccttgcagtccaactacgctaggaattttaggtagtcccacttgcattcaccataa 397  T
159 catcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatct 239  Q
    ||||||||| ||| ||||||||| ||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||    
398 catcttcaatgcagaacatctcccgcttccttgaagaccaccttgcatccaatcaccattggccttcttttagagtaatct 478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1674; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 42 - 166
Target Start/End: Original strand, 185 - 308
Alignment:
42 cacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtccc 141  Q
    ||||||| |||||| | ||||| ||||| ||  |||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
185 cacaagtttacaccccataaccccttcagccctcggaatgtcttccgccttctcgaag-gtccttgtagtccaactacactaggagttttaggtagtccc 283  T
142 acaagcattcaccataacatcttca 166  Q
    ||||||||||||| |||| ||||||    
284 acaagcattcaccttaacctcttca 308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: scaffold0025
Description:

Target: scaffold0025; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 82 - 238
Target Start/End: Original strand, 70061 - 70217
Alignment:
82 tcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataacatctcc 181  Q
    ||||||| ||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||  ||||||||    
70061 tcttccgtcttctcgaagagtacttgcagtccaactacgctaggaattttaggtagtcccacaagcattcaccataacatcttcaatgcaggacatctcc 70160  T
182 tgcttccttgaagatcaccttgcatccaatcacccttggcattcttttagaataatc 238  Q
     |||||||||||| |||||||||||||||||||||||||| |||||||||| |||||    
70161 cgcttccttgaaggtcaccttgcatccaatcacccttggccttcttttagagtaatc 70217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 166
Target Start/End: Original strand, 69922 - 70048
Alignment:
40 tccacaagtatacacctcgtaaccacttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtc 139  Q
    ||||||||| |||||||| ||||| ||||| ||  |||||| |||||||||||||||||  |||||||||||||||||||||||||| ||||||||||      
69922 tccacaagtttacacctcataaccccttcagccctcggaatgtcttccgccttctcgaaaggtccttgcagtccaactacactaggaattttaggtagct 70021  T
140 ccacaagcattcaccataacatcttca 166  Q
    ||||||||||||||| |||| ||||||    
70022 ccacaagcattcaccttaacctcttca 70048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 75 - 231
Target Start/End: Complemental strand, 51488 - 51333
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||  |    
51488 cggaatgtcttccgccttctcgaag-gtccttgcagtccatctacactaggaattttaggtagttccacaagcattcaccataacatcttcaacacagga 51390  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggcattcttttag 231  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||    
51389 catctcccgcttccttgaagatcaccttgcatccaatcacccttggcctttttttag 51333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 35365 - 35220
Alignment:
75 cggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtcccacaagcattcaccataacatcttcaacgcataa 174  Q
    |||||| |||||||||||||||||| ||||||| |||| |||||| |||||  ||||||||||| |||||||||||||||||||| |||||||| ||  |    
35365 cggaatgtcttccgccttctcgaag-gtccttgtagtctaactacgctaggtattttaggtagttccacaagcattcaccataacctcttcaacacagga 35267  T
175 catctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    ||||||| | |||||||||| || |||||||||||||||||||||||    
35266 catctcccgtttccttgaaggtctccttgcatccaatcacccttggc 35220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0133 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold0133
Description:

Target: scaffold0133; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 4269 - 4107
Alignment:
65 cttcacccaccggaatatcttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagtccca-------caagcattcaccata 157  Q
    ||||| ||| |||||| |||||||||||||||||||| |||||||||||||||||||||| | ||||||||||| |||       |||| || |||||||    
4269 cttcagccaacggaatgtcttccgccttctcgaagag-ccttgcagtccaactacactagaaattttaggtagttccatattccacaagtatccaccata 4171  T
158 acatcttcaacgcataacatctcctgcttccttgaagatcaccttgcatccaatcacccttggc 221  Q
    || |||||||| ||  |||||||| ||||||||||||||| |||| ||||||||||||||||||    
4170 acctcttcaacacaggacatctcccgcttccttgaagatctccttacatccaatcacccttggc 4107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0133; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 138
Target Start/End: Complemental strand, 4346 - 4293
Alignment:
84 ttccgccttctcgaagagtccttgcagtccaactacactaggagttttaggtagt 138  Q
    ||||| |||||||||| |||||||||||||||||||||||||| ||| |||||||    
4346 ttccgacttctcgaag-gtccttgcagtccaactacactaggaatttgaggtagt 4293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 189206 - 189151
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtatacacctc 57  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
189206 atctacttgtacccaatcacccttggc-ttttagagtaatccacaagtatacacctc 189151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0250 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0250
Description:

Target: scaffold0250; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 2397 - 2348
Alignment:
1 atctacttgtacccaatcacccttggctttttagagtaatccacaagtata 51  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||    
2397 atctacttgtacccaatcacccttggc-ttttagagtaatccacaagtata 2348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1899 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1899
Description:

Target: scaffold1899; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 239
Target Start/End: Complemental strand, 1256 - 1213
Alignment:
196 tcaccttgcatccaatcacccttggcattcttttagaataatct 239  Q
    |||||||||||||||||||||||||| |||||||||| ||||||    
1256 tcaccttgcatccaatcacccttggccttcttttagagtaatct 1213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141814 times since January 2019
Visitors: 1478