View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_25 (Length: 244)

Name: NF1565_low_25
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_25
NF1565_low_25
[»] chr1 (1 HSPs)
chr1 (1-237)||(14100161-14100401)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 14100401 - 14100161
Alignment:
1 ttatcaacatgaatttttcacaaaattacaactcggagtagctgttagttttaattttaaaagatcaatgtcaaaaatcaaagttggtgaatttgtattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14100401 ttatcaacatgaatttttcacaaaattacaactcggagtagctgttagttttaattttaaaagatcaatgtcaaaaatcaaagttggtgaatttgtattg 14100302  T
101 gagcaccggtgtcaaatttcatggcattgattagtttgacttcttaataaaacaaacaatgttaaacaaactgatcagagaaaatcaagatgtt----gc 196  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||    
14100301 gagcaccggtgtcaaattccatggcatggattagtttgacttcttaataaaacaaacaatgttaaacaaactgatcagagaaaatcaagatgttgcttgc 14100202  T
197 ttcctttttaaaacctctttcaattccattcatctcgagaa 237  Q
    |||||||||||||||||||||||||||||||||||||||||    
14100201 ttcctttttaaaacctctttcaattccattcatctcgagaa 14100161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150189 times since January 2019
Visitors: 1518