View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_26 (Length: 241)

Name: NF1565_low_26
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_26
NF1565_low_26
[»] chr5 (1 HSPs)
chr5 (18-234)||(7037658-7037874)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 7037874 - 7037658
Alignment:
18 ggtgcgacaaggaactaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggtggaagtatcacacatctg 117  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||     
7037874 ggtgcgacaaggaaccaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggcgaaagtatcacacatcta 7037775  T
118 cctctcttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagattactcccctagttgttttggcggtgtatcctcctc 217  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||| |||||||||||||    
7037774 cctctgttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagatgactccgttagttgttttggcagtgtatcctcctc 7037675  T
218 ctaatctatctctgctc 234  Q
    ||||||||||| |||||    
7037674 ctaatctatctttgctc 7037658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149770 times since January 2019
Visitors: 1518